Mus spicilegus (steppe mouse) microRNA 344 (ENSMSIG00000032145.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus spicilegus (steppe mouse) microRNA 344 (ENSMSIG00000032145.1) URS000071EB77_10103

95 nucleotides
1 database (Ensembl)
Found in 4 other species
5 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUGCAGCCAGGGUUUUUACCAGUCAGGCUCCUGGCUAGAUUCCAGGUACCAGCUGGUACCUGAUCUAGCCAAAGCCUGACUGUAAGCCCUGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Mus caroli microRNA 344 (MGP_CAROLIEiJ_G0008117.1)
Mus musculus (house mouse) microRNA mmu-mir-344 precursor (mmu-mir-344-1)
Mus spretus microRNA 344 (MGP_SPRETEiJ_G0008541.1)

Publications