Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 72 (SNORD72) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 72 (SNORD72) URS000071E913_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD72: SNORD72 is a small nucleolar RNA (snoRNA) that has been studied in various contexts. Knockdown of lncRNA-LALR1 resulted in a significant decrease in SNORD72 expression, as well as ID2 expression [PMC7093170]. In different studies, SNORD72 has been used as a reference gene for normalization purposes. For example, the expression of miRNAs was normalized to the average of six housekeeping small RNAs, including SNORD72 [PMC7132342]. In another study, relative expression was normalized to the mean threshold cycle (CT) values of multiple reference genes, including SNORD72 [PMC10022860]. Additionally, normalization to endogenous control genes such as SNORD72 has been used to correct for potential biases in RNA input or reverse transcription efficiency [PMC7801461]. These studies highlight the importance of SNORD72 as a reference gene for normalization purposes in different experimental settings.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUAUCAGUGAUGUUGUAAAAAUAAAUGUCUGAACAUAUGAAUGCAGUAUUGAUUUCAGCAUUUAACUGAGAUAAGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla Small nucleolar RNA SNORD72
  2. Pan troglodytes Small nucleolar RNA SNORD72
2D structure Publications