Rattus norvegicus (Norway rat) microRNA rno-mir-300 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-300 precursor URS000071A79E_10116

79 nucleotides
4 databases (miRBase, RefSeq, Rfam, RGD)
Found in 7 other species
564 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCUACUUGAAGAGAGGUUAUCCUUUGUGUGUUUGCUUUACGCGAAAUGAAUAUGCAAGGGCAAGCUCUCUUCGAGGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Cricetulus griseus (Chinese hamster) microRNA mir-300 (ENSCGRG00000021654.1, ENSCGRG00001004795.1)
Microtus ochrogaster microRNA 300 (ENSMOCG00000005103.1)
Mus caroli microRNA 300 (MGP_CAROLIEiJ_G0007282.1)
Mus musculus microRNA mmu-mir-300 precursor
Mus pahari (Shrew mouse) microRNA 300 (MGP_PahariEiJ_G0007673.1)
Mus spretus (algerian mouse) microRNA 300 (MGP_SPRETEiJ_G0007627.1)
Neotoma lepida mir-154 microRNA precursor family

2D structure

Publications