Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-922 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-922 precursor URS0000718B2A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-922: Hsa-mir-922 is a microRNA that has been designed and synthesized by Shanghai GenePharma Co., Ltd. as a mimic and inhibitor [PMC8020205]. It has been found to regulate the expression and activity of the RUNX1 gene by interacting with other microRNAs, such as hsa-miR-603, hsa-miR-330-3p, hsa-miR-646, and hsa-mir-922 [PMC7886988]. These microRNAs can be sponged by multiple circular RNAs (circRNAs) [PMC7886988]. In the context of cancer-related target genes, hsa-mir-922 has been reported to regulate genes such as CASR, CDC25B, NFκB1, and SHOC2 [PMC8240180]. In other studies related to liver function and immune response modulation, hsa-mir-922 has been identified as one of the key microRNAs that negatively regulate downstream target genes [PMC4121398]. In the context of IgA nephropathy (IgAN), hsa-mir-922 is associated with upregulation of TGFBRAP1 gene expression [PMC9896983]. However, a correlation study between hsa-mir-922 and TGFBRAP1 in nephropathy has not yet been found [PMC9896983]. Overall, these studies highlight the regulatory role of hsa-mir-922 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGCGUUUUCCCUCUCCCUGUCCUGGACUGGGGUCAGACUGUGCCCCGAGGAGAAGCAGCAGAGAAUAGGACUACGUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 922 (ENSGGOG00000031454.2)
2D structure Publications