Pan paniscus (bonobo) microRNA 802 (ENSPPAG00000001366.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 802 (ENSPPAG00000001366.1) URS000070FC11_9597

94 nucleotides
1 database (Ensembl)
Found in 2 other species
27 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUUCUGUUAUUUGCAGUCAGUAACAAAGAUUCAUCCUUGUGUCCAUCAUGCAACAAGGAGAAUCUUUGUCACUUAGUGUAAUUAAUAGCUGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Gorilla gorilla gorilla microRNA 802 (ENSGGOG00000031946.2)
Homo sapiens microRNA hsa-mir-802 precursor

Publications