Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Val (anticodon TAC) 1-1 (TRV-TAC1-1, TRV-TAC1-2) secondary structure diagram

Homo sapiens (human) tRNA-Val (anticodon TAC) 1-1 (TRV-TAC1-1, TRV-TAC1-2) URS000070B37B_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUAGUGUAGUGGUUAUCACGUCUGCUUUACACGCAGAAGGUCCUGGGUUCGAGCCCCAGUGGAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 106 other species

  1. Acanthisitta chloris tRNA
  2. Albula glossodonta tRNA-OTHER
  3. Albula goreensis tRNA-Val
  4. Alligator mississippiensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  5. Alligator sinensis (Chinese alligator) tRNA
  6. Amazona aestiva tRNA
  7. Ameiurus melas tRNA-Val
  8. Anguilla anguilla tRNA-Val
  9. Anolis carolinensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  10. Apaloderma vittatum tRNA
  11. Aptenodytes forsteri (emperor penguin) tRNA
  12. Astyanax mexicanus tRNA
  13. Balaenoptera acutorostrata scammoni tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  14. Balearica regulorum gibbericeps tRNA
  15. Callipepla squamata (scaled quail) tRNA
  16. Callithrix jacchus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  17. Callorhinchus milii tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  18. Calypte anna (Anna's hummingbird) tRNA
  19. Camelus ferus (Wild Bactrian camel) tRNA
  20. Canis lupus familiaris tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  21. Cariama cristata tRNA
  22. Carlito syrichta tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  23. Cavia porcellus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  24. Ceratotherium simum simum tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  25. Charadrius vociferus tRNA
  26. Chelydra serpentina tRNA-Val
  27. Chlamydotis macqueenii tRNA
  28. Chlorocebus sabaeus tRNA-Val (TAC) (tRNA-Val-TAC-2-1, tRNA-Val-TAC-2-2)
  29. Chrysemys picta bellii tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  30. Colinus virginianus tRNA
  31. Columba livia (rock pigeon) partial tRNA-Val
  32. Cricetulus griseus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  33. Cuculus canorus (common cuckoo) tRNA
  34. Dallia pectoralis tRNA-Val
  35. Danionella translucida tRNA-Val
  36. Danio rerio tRNA-Val (TAC) (tRNA-Val-TAC-4-1)
  37. Dasypus novemcinctus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  38. Dreissena polymorpha tRNA-Val
  39. Echinops telfairi tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  40. Egretta garzetta tRNA
  41. Eptesicus nilssonii tRNA-Val
  42. Equus caballus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  43. Eurypyga helias tRNA
  44. Felis catus tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  45. Ficedula albicollis tRNA
  46. Gadus morhua tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  47. Gallus gallus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  48. Geospiza fortis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  49. Gorilla gorilla gorilla tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  50. Ictidomys tridecemlineatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  51. Lamprotornis superbus tRNA-OTHER
  52. Latimeria chalumnae (coelacanth) tRNA
  53. Lepisosteus oculatus (spotted gar) tRNA
  54. Leptosomus discolor tRNA
  55. Lonchura striata domestica tRNA
  56. Loxodonta africana tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  57. Macaca mulatta tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  58. Manacus vitellinus (golden-collared manakin) tRNA
  59. Marmota monax tRNA.Val
  60. Megalops atlanticus tRNA-Val
  61. Meleagris gallopavo tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  62. Melopsittacus undulatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  63. Merluccius polli tRNA-Val
  64. Merops nubicus tRNA
  65. Mesitornis unicolor (brown roatelo) tRNA
  66. Mesocricetus auratus (golden hamster) tRNA
  67. Monodelphis domestica tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  68. Mus musculus domesticus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  69. Mustela putorius furo tRNA-Val (TAC) (tRNA-Val-TAC-2-1)
  70. Nipponia nippon tRNA
  71. Nomascus leucogenys tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  72. Ochotona princeps tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  73. Ophiophagus hannah (king cobra) tRNA
  74. Ornithorhynchus anatinus tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  75. Oryctolagus cuniculus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  76. Pangasianodon gigas (Mekong giant catfish) tRNA-Val
  77. Pangasianodon hypophthalmus tRNA-Val
  78. Pangasius djambal tRNA-Val
  79. Pan troglodytes tRNA-Val (TAC) (tRNA-Val-TAC-11-1)
  80. Papio anubis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  81. Patagioenas fasciata monilis tRNA
  82. Pelobates cultripes (western spadefoot toad) tRNA.Val
  83. Petromyzon marinus tRNA-Val (TAC) (tRNA-Val-TAC-3-1)
  84. Phaethon lepturus tRNA
  85. Phoenicopterus ruber ruber tRNA
  86. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  87. Dryobates pubescens tRNA
  88. Podarcis lilfordi tRNA.Val
  89. Pongo abelii tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-3)
  90. Procavia capensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  91. Saimiri boliviensis boliviensis tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  92. Salmo salar tRNA
  93. Sarcophilus harrisii tRNA-Val (TAC) (tRNA-Val-TAC-1-1, tRNA-Val-TAC-1-2)
  94. Scleropages formosus (Asian bonytongue) tRNA
  95. Sphaerodactylus townsendi tRNA-Val
  96. Struthio camelus australis tRNA
  97. Sus scrofa tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  98. Taeniopygia guttata tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  99. Tinamus guttatus tRNA
  100. Trichechus manatus latirostris tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  101. Tupaia chinensis tRNA
  102. Tursiops truncatus tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
  103. Vicugna pacos tRNA-Val (TAC) (tRNA-Val-TAC-1 1 to 3)
  104. Xenopus laevis tRNA
  105. Xenopus tropicalis tRNA-Val (TAC) (tRNA-Val-TAC-1-1)
2D structure Publications