Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-609 precursor URS00006E8036_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-609: Hsa-mir-609 is a microRNA (miRNA) that has been found to be involved in the regulation of various genes, including GPX1, GPX2, GPX3, and GPX4 [PMC9848624]. It has also been identified as one of the novel miRNAs targeting PCSK9 [PMC8310920]. Hsa-mir-609 is part of a circRNA-miRNA-mRNA interaction network that includes other miRNAs such as hsa-miR-3152-3p, hsa-miR-6071, and hsa-miR-675-5p [PMC9433285]. It has been shown to be connected to genes such as hsa-miR-371a-5p and hsa-miR-374b-5p [PMC6678685]. Hsa-mir-609 has also been used as a negative control in certain studies [PMC3669147]. In EBV-positive BL cases, it was found to be down-regulated along with other miRNAs such as hsa-miR-181d and hsa-miR142-5b [PMC4005456]. Additionally, it was identified as one of the top up-regulated DEmiRNAs in certain conditions [PMC9814319]. Hsa-mir-609 is part of a network that includes other miRNAs such as hsa-mir let7 family and hsa-mir 143 [PMC3424689]. It has also been shown to have conserved binding sites with circSLC3A2, circGCLM, circPCBP2, circTFRC, and circVDAC3 in the ferroptosis pathway [PMC9149005]. Finally, it has been found to be involved in the downregulation of the RAG2 gene through the liberation of hsa-mir-609 [PMC9030292].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCGGCUGUUCCUAGGGUGUUUCUCUCAUCUCUGGUCUAUAAUGGGUUAAAUAGUAGAGAUGAGGGCAACACCCUAGGAACAGCAGAGGAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications