Vicugna pacos (alpaca) microRNA 105-2 (ENSVPAG00000017137.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vicugna pacos (alpaca) microRNA 105-2 (ENSVPAG00000017137.1) URS00006E735F_30538

80 nucleotides
1 database (Ensembl)
Found in 8 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGUGCAUCGUGGUCAAAUGCUCAGACUCCUUGGUGGCUGCUUAUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Balaenoptera musculus (Blue whale) microRNA 105-2 (ENSBMSG00010021364.1)
Camelus dromedarius (Arabian camel) microRNA 105-2 (ENSCDRG00005017589.1)
Camelus ferus mir-105 microRNA precursor family
Cervus elaphus hippelaphus ncRNA
Cervus hanglu yarkandensis microRNA 105-2 (ENSCHYG00000023035.1)
Ovis aries miRNA (ENSOARG00000025044.1, ENSOARG00020025110.2)
Physeter catodon microRNA 105-2 (ENSPCTG00005018846.1)
Sus scrofa (pig) microRNA ssc-mir-105 precursor (ssc-mir-105-2)

2D structure