Automated summary: This snoRNA sequence is 282 nucleotides long and is found in Magnaporthiopsis poae ATCC 64411. Annotated by 2 databases (Rfam, Ensembl Fungi). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_U3, RF01846). Magnaporthe poae ATCC 64411 fungal small nucleolar RNA U3 sequence is a product of EFMPG00000000044, ENSRNA049509366 genes. Found in the Magnaporthiopsis poae ATCC 64411 reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUCGACAAUACUUCAGAGAAUCAUUUCUAUAGUAUUUGUCCCACUUCUUUGUUUCCCAAAGAAGCUUCAGAUCCCACCCUGGUUGAUGACCACAAAUCCUCGCCGCCCUCGAGUGAAUACUCUUAUUUUUGUCCCUCGCUCUGUCCGUAAGGAUGGCGGAGACGGUGCGCUUCGCGCGCUGCUGUCUCUGUAUAGAGGACUGUGAUGAUCUCUAUCCCGAUCACCCAGGGUCUUGCCUUCGGGCGCCUGGGCGGGAUGGGCAGCGAUGGACGUCUGACAGGC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.