Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Magnaporthe poae ATCC 64411 fungal small nucleolar RNA U3 secondary structure diagram

Magnaporthe poae ATCC 64411 fungal small nucleolar RNA U3 URS00006E4BC8_644358

Automated summary: This snoRNA sequence is 282 nucleotides long and is found in Magnaporthiopsis poae ATCC 64411. Annotated by 2 databases (Rfam, Ensembl Fungi). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_U3, RF01846). Magnaporthe poae ATCC 64411 fungal small nucleolar RNA U3 sequence is a product of ENSRNA049509366, EFMPG00000000044 genes. Found in the Magnaporthiopsis poae ATCC 64411 reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCGACAAUACUUCAGAGAAUCAUUUCUAUAGUAUUUGUCCCACUUCUUUGUUUCCCAAAGAAGCUUCAGAUCCCACCCUGGUUGAUGACCACAAAUCCUCGCCGCCCUCGAGUGAAUACUCUUAUUUUUGUCCCUCGCUCUGUCCGUAAGGAUGGCGGAGACGGUGCGCUUCGCGCGCUGCUGUCUCUGUAUAGAGGACUGUGAUGAUCUCUAUCCCGAUCACCCAGGGUCUUGCCUUCGGGCGCCUGGGCGGGAUGGGCAGCGAUGGACGUCUGACAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure New