Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-649 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-649 precursor URS00006DE1AC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-649: Hsa-mir-649 is a microRNA that has been identified as a putative binding miRNA in several studies [PMC7467373]. It has been predicted to alter binding sites for microRNAs, including hsa-miR-509 and hsa-mir-649, in the NFAT5 messenger RNA [PMC4930134]. However, no effect on gene expression was detected for rs11641233 in the presence of hsa-mir-649 [PMC4930134]. Hsa-mir-649 has also been found to be co-targeted with TET genes [PMC8798779]. In a study using LASSO analysis, hsa-mir-649 was identified as one of the potential predictors for patient survival [PMC5601660]. Hsa-mir-649 has also been found to have binding sites for several other miRNAs, including hsa-miR-203a and hsa-miR-127 [PMC7497355]. It is worth noting that other studies have linked hsa-mir-649 to autism and DiGeorge syndrome [PMC3965395] [PMC3087710]. Additionally, several miRNAs associated with down-regulated genes have been identified, including hsa-mir-649 [PMC9478394]. References: [PMC7467373] - Supplementary Table 5 [PMC4930134] - Supplementary Figure 4 [PMC8798779] - Figure 13B [PMC5601660] - Figure 1A and 1B [PMC7497355] - Supplementary Table 2 [PMC3965395] [PM3087710] [PM9478394] - Figure 5

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUAGCCAAAUACUGUAUUUUUGAUCGACAUUUGGUUGAAAAAUAUCUAUGUAUUAGUAAACCUGUGUUGUUCAAGAGUCCACUGUGUUUUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 649 (ENSGGOG00000031475.2)
2D structure Publications