Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-150 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-150 precursor URS00006B7D0F_9606

  • 84 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 14 species

Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, MalaCards, Ensembl/GENCODE, Ensembl, ENA, HGNC, miRBase, GeneCards, Rfam). Described in 60 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-150, RF00767). Homo sapiens (human) microRNA hsa-mir-150 precursor sequence is a product of mir-150, 150, hsa-mir-150 precursor, mir-150 precurso, MIR150, mir-150 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACCUGGGGAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Chlorocebus sabaeus (African green monkey) miRNA
    3. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 150
    4. Macaca fascicularis (Crab-eating macaque) miRNA
    5. Macaca mulatta microRNA mml-mir-150 precursor
    6. Macaca nemestrina miRNA
    7. Mandrillus leucophaeus (Drill) miRNA
    8. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    9. Pan paniscus (bonobo) miRNA
    10. Pan troglodytes (chimpanzee) ptr-mir-150
    11. Papio anubis (Olive baboon) miRNA
    12. Pongo abelii microRNA 150
    13. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-150 precursor
    14. Rhinopithecus bieti miRNA
    15. Rhinopithecus roxellana microRNA 150
    2D structure New