Chinchilla lanigera (Long-tailed chinchilla) microRNA 874 (ENSCLAG00000021339.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chinchilla lanigera (Long-tailed chinchilla) microRNA 874 (ENSCLAG00000021339.1) URS00006B4494_34839

76 nucleotides
1 database (Ensembl)
Found in 11 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUAGCCCUGCGGCCCCACGCACCAGGGUAAGAGAGACUCGCUUCCUGCCCUGGCCCGAGGGACCGACUGGCUGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Capra hircus microRNA mir-874 (ENSCHIG00000002261.1)
Meriones unguiculatus miRNA (ENSMUGG00000007645.1)
Microtus ochrogaster (vole) microRNA 874 (ENSMOCG00000010787.1)
Mus caroli microRNA 874 (MGP_CAROLIEiJ_G0007335.1)
Mus pahari microRNA 874 (MGP_PahariEiJ_G0006979.1)
Neotoma lepida microRNA mir-874
Octodon degus (Degu) microRNA 874 (ENSODEG00000022001.1)
Ovis aries (sheep) miRNA (ENSOARG00000022926.1)
Peromyscus maniculatus bairdii microRNA 874 (ENSPEMG00000001766.2)
Propithecus coquereli miRNA (ENSPCOG00000002499.1)
Rattus norvegicus microRNA rno-mir-874 precursor

2D structure