v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cricetulus griseus (Chinese hamster) microRNA mir-154 secondary structure diagram

Cricetulus griseus (Chinese hamster) microRNA mir-154 URS000069AD99_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUACUCGGAGAGAGGUUACCCGAGCAACUUUGCAUCUGGAGGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Mesocricetus auratus microRNA mir-154
  2. Mus musculus microRNA mir-154
  3. Neotoma lepida microRNA mir-154
  4. Rattus norvegicus microRNA rno-mir-409a precursor
 2D structure Publications