v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus (African green monkey) Small nucleolar RNA SNORD115 (ENSCSAG00000022890.1, ENSCSAG00000024149.1) secondary structure diagram

Chlorocebus sabaeus (African green monkey) Small nucleolar RNA SNORD115 (ENSCSAG00000022890.1, ENSCSAG00000024149.1) URS000069A5FA_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGUCGAUGAUGAGAACCUUAUAUUGUUCUGAAGAGAGGUGAUGACUUAAAAAUCAUGCUCAAUAGGAUUACGCUGAGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Aotus nancymaae (Ma's night monkey) Small nucleolar RNA SNORD115 (ENSANAG00000013876.1)
  2. Callithrix jacchus Small nucleolar RNA SNORD115 (ENSCJAG00000074480.1, ENSCJAG00000077098.1, ENSCJAG00000077556.1)
  3. Gorilla gorilla gorilla (Western Lowland Gorilla) Small nucleolar RNA SNORD115 (ENSGGOG00000043818.1)
  4. Homo sapiens (human) small nucleolar RNA, C/D box 115-42 (SNORD115-42)
  5. Macaca fascicularis Small nucleolar RNA SNORD115 (ENSMFAG00000064500.1)
  6. Macaca mulatta Small nucleolar RNA SNORD115 (ENSMMUG00000049409.1)
  7. Nomascus leucogenys Small nucleolar RNA SNORD115 (ENSNLEG00000036239.1)
  8. Papio anubis Small nucleolar RNA SNORD115 (ENSPANG00000037704.1, ENSPANG00000042216.1)
  9. Pongo abelii Small nucleolar RNA SNORD115 (ENSPPYG00000031343.1, ENSPPYG00000036510.1)
 2D structure Publications