Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 544a (ENSNLEG00000024300.2) URS0000674174_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUUUCAUCACCUAGGGAUCUUGUUAAAAAGCAGAUUCUGAUUCAGGGACCAAGAUUCUGCAUUUUUAGCAAGUUCUCAAGUGAUGCUAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Aotus nancymaae miRNA (ENSANAG00000008828.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA cja-mir-544 precursor
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 544a (ENSCCAG00000031197.1)
  4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000009889.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 544a (ENSCSAG00000022422.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000007280.1)
  7. Fukomys damarensis microRNA mir-544
  8. Gorilla gorilla gorilla microRNA 544a (ENSGGOG00000029800.2)
  9. Heterocephalus glaber microRNA 544a (ENSHGLG00000022551.2, ENSHGLG00100024147.2)
  10. Homo sapiens microRNA hsa-mir-544a precursor
  11. Macaca fascicularis microRNA 544a (ENSMFAG00000013085.2)
  12. Macaca mulatta microRNA mml-mir-544 precursor
  13. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000015119.1)
  14. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010390.1)
  15. Pan paniscus microRNA 544a (ENSPPAG00000007368.1)
  16. Pan troglodytes ptr-mir-544 (ENSPTRG00000028102.2)
  17. Papio anubis (olive baboon) miRNA (ENSPANG00000027465.3)
  18. Piliocolobus tephrosceles miRNA (ENSPTEG00000002632.1)
  19. Pongo abelii miRNA (ENSPPYG00000021038.2)
  20. Pongo pygmaeus microRNA ppy-mir-544 precursor
  21. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000023361.1)
  22. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000019171.1)
  23. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000027616.1)
  24. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019370.1)
  25. Theropithecus gelada (gelada) microRNA 544a (ENSTGEG00000007597.1)
  26. Tupaia belangeri microRNA 544a (ENSTBEG00000018032.1)
  27. Tupaia chinensis microRNA mir-544
Publications