Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-944 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-944 precursor URS0000663F9C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir944: MIR944 is a microRNA that has been identified as overexpressed in patients with non-small cell lung cancer (NSCLC) relative to healthy controls, with a more than fourfold increase in expression [PMC5627048]. It has been implicated in modulating sensitivity to chemotherapy in solid tumors [PMC8602334]. The MIR944 promoter is transcriptionally regulated by ΔNp63, particularly during keratinocyte differentiation, with ΔNp63 binding to the promoter maintained during this process [PMC4551945]. Co-regulators such as TFAP2A and TFAP2C have been identified as supporting the binding of ΔNp63 to the MIR944 promoter, suggesting a complex regulatory mechanism that maintains miR-944 expression during epidermal differentiation [PMC4551945]. The chromatin architecture of the MIR944 genomic region is open in keratinocytes, facilitating transcription initiation [PMC4551945]. Conservation analyses indicate that MIR944 is evolutionarily young and primate-specific, suggesting its recent emergence and potential specialized function in these species [PMC4551945]. Overall, MIR944 appears to be an important regulatory miRNA with its own promoter within the intron of ΔNp63 and may play a role in epidermal differentiation and cancer biology [PMC4551945][PMC6510770].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCCAGACACAUCUCAUCUGAUAUACAAUAUUUUCUUAAAUUGUAUAAAGAGAAAUUAUUGUACAUCGGAUGAGCUGUGUCUGGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications