Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-631 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-631 precursor URS000065B212_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-631: Hsa-mir-631 is a microRNA that has been studied in various contexts [PMC7139792][PMC5945511][PMC9792611][PMC5519761][PMC6753562]. During the development of bortezomib resistance in cells, the levels of hsa-mir-631 are decreased, leading to an increase in UBE2C gene expression [PMC7139792]. In primary resistant/refractory tumors, hsa-mir-631 is down-regulated [PMC5945511]. In prostate cancer cells, hsa-mir-631 inhibits migration and invasion by targeting ZAP70 [PMC5945511]. In PBMAH subtype 2, the expression of hsa-mir-631 is significantly lower compared to adenoma [PMC9792611]. However, during validation by qRT-PCR, the expression of hsa-mir-631 was not significantly altered between adenoma and PBMAH [PMC9792611]. Hsa-mir-631 has also been used as an internal control in plasma exosomes analysis [PMC5519761]. In OSAHS patients compared to controls, hsa-mir-631 was not significantly differentially expressed [PMC6753562].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGGGAGCCUGGUUAGACCUGGCCCAGACCUCAGCUACACAAGCUGAUGGACUGAGUCAGGGGCCACACUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications