Delphinapterus leucas (beluga whale) microRNA 191 (ENSDLEG00000018194.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Delphinapterus leucas (beluga whale) microRNA 191 (ENSDLEG00000018194.1) URS0000641524_9749

91 nucleotides
1 database (Ensembl)
Found in 7 other species
70 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCACUUGGAUUUCGUUCCCUGCUCUCCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Balaenoptera musculus (Blue whale) microRNA 191 (ENSBMSG00010010122.1)
Monodon monoceros (narwhal) microRNA 191 (ENSMMNG00015012372.1)
Mus musculus (house mouse) microRNA mir-191
Phocoena sinus microRNA 191 (ENSPSNG00000006032.1)
Physeter catodon microRNA 191 (ENSPCTG00005022101.1)
Rattus norvegicus microRNA rno-mir-191a precursor
Tursiops truncatus (bottlenosed dolphin) microRNA 191 (ENSTTRG00000023018.1)

Publications