v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) Small nucleolar RNA SNORD11 secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) Small nucleolar RNA SNORD11 URS000063A91D_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGUUCAAUGAUGAUUUCUAUUUGUUUGCCUGAUUUCCUUUUGGAUAAUGAAGGCAUCUUUAGUCACUACCUCUUCUGAGACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cercocebus atys snoRNA (ENSCATG00000021441.1)
  2. Chlorocebus sabaeus small nucleolar RNA, C/D box 11 (ENSCSAG00000020428.1)
  3. Gorilla gorilla gorilla small nucleolar RNA, C/D box 11 (ENSGGOG00000033251.2)
  4. Homo sapiens small nucleolar RNA, C/D box 11 (SNORD11)
  5. Macaca fascicularis (Crab-eating macaque) small nucleolar RNA, C/D box 11 (ENSMFAG00000006419.2)
  6. Macaca mulatta (Macaque) small nucleolar RNA, C/D box 11 (ENSMMUG00000037056.3)
  7. Macaca nemestrina (Pig-tailed macaque) snoRNA (ENSMNEG00000020678.1)
  8. Mandrillus leucophaeus (Drill) snoRNA (ENSMLEG00000024349.1)
  9. Pan troglodytes Small nucleolar RNA SNORD11
  10. Papio anubis snoRNA (ENSPANG00000006528.3)
  11. Rhinopithecus bieti (Black snub-nosed monkey) snoRNA (ENSRBIG00000012772.1)
  12. Rhinopithecus roxellana snoRNA (ENSRROG00000009549.1)
  13. Theropithecus gelada (gelada) small nucleolar RNA SNORD11 (ENSTGEG00000029216.1)
 2D structure Publications