v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pelobates cultripes (western spadefoot toad) tRNA.Glu secondary structure diagram

Pelobates cultripes (western spadefoot toad) tRNA.Glu URS0000639DBE_61616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAUAUGGUCUAGCGGUUAGGAUUCCUGGUUUUCACCCAGGUGGCCCGGGUUCGACUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Actinia tenebrosa tRNA-Glu
  2. Albula goreensis tRNA-Glu
  3. Dallia pectoralis tRNA-Glu
  4. Danionella translucida tRNA-Glu
  5. Danio rerio tRNA-Glu (TTC) (tRNA-Glu-TTC-4 1 to 8)
  6. Hippoglossus stenolepis tRNA-Glu
  7. Homo sapiens tRNA-Glu (anticodon TTC) 1-1 (TRE-TTC1-1, TRE-TTC1-2)
  8. Orbicella faveolata tRNA-Glu
  9. Salmo salar (Atlantic salmon) tRNA
 2D structure