v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mesocricetus auratus (golden hamster) mir-154 microRNA precursor family secondary structure diagram

Mesocricetus auratus (golden hamster) mir-154 microRNA precursor family URS0000628222_10036

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUGUGACGAAUCAUUCACGGACAACACUUUUUUCAGUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cricetulus griseus (Chinese hamster) mir-154 microRNA precursor family
  2. Mus musculus mir-154 microRNA precursor family
  3. Neotoma lepida (desert woodrat) mir-154 microRNA precursor family
  4. Rattus norvegicus microRNA rno-mir-382 precursor
 2D structure Publications