Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-155 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-155 precursor URS000062749E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir155: MIR155 is a noncoding microRNA transcript of the B-cell integration cluster gene, implicated in the regulation of various cellular processes, including immune response and oncogenesis [PMC7912829]. It has been observed to play a role in osteogenic differentiation, with its inhibition leading to upregulated osteogenesis of mesenchymal stem cells [PMC9288680]. Studies using MIR155 knockout mice suggest its involvement in macrophage accumulation and metabolic profile regulation in obesity settings [PMC5617927]. MIR155 is also associated with autophagic activity, with its overexpression increasing and knockdown alleviating autophagy under hypoxic conditions [PMC4389881]. Its role extends to vascular smooth muscle cell proliferation and has been proposed as a potential target for future research on vascular calcification using cell type-specific knockout models [PMC7123062], [PMC7810936]. Additionally, MIR155 is recognized as an oncomiR due to its involvement in various cancers including breast cancer, leukemia, lymphoma, lung cancer, and liver cancer [PMC5361868]. Its expression profile has been associated with the diagnosis and progression of breast cancer when examined alongside other microRNAs [PMC3046429]. Furthermore, MIR155's regulatory effects on immune cells have been highlighted for their potential implications in autoimmune diseases such as rheumatoid arthritis [PMC8534545], [PMC5351619].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA 155 (ENSGGOG00000030092.2)
  2. Gorilla gorilla microRNA mir-155
  3. Pan paniscus ppa-mir-155 (ENSPPAG00000013966.1)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

GoFlow Results Publications