Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-554 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-554 precursor URS0000626340_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-554: Hsa-mir-554 is a microRNA that was used as a primer in a study [PMC7043771]. In the study, several microRNAs, including hsa-mir-554, hsa-miR-601, hsa-miR-325, hsa-miR-103b, and hsa-miR-628-3p, were observed more clearly than others [PMC8217230]. Other microRNAs that were identified in the study included hsa-mir-1178, hsa-mir-1276, hsa-mir-197, hsa-mir-217, hsa-mir-485-3p, and more [PMC6794874]. Additionally, 12 aberrant miRNAs were identified in plasma from patients with sleep disorder: hsa-mir-1267, hsa-miR4309,h sa mir 554,h sa mi R1272,h sa mi R4501,h sa mi R1823p,h sa mi R6255p,h sa mi R1005p,h sa mi R125b5p,h sa mir 1973p,h sa mir 4522 andh sami r4935 p [PMC4690823]. These aberrant miRNAs showed either up-regulation or down-regulation in peripheral blood samples [PMC4690823]. Furthermore,qRT PCR validation showed that some of these aberrant miRNAs had significantly high expression (hsa mir1267 ,hsa mir4309 ,hsa mir554 ,hsa mir1272 ,hsa mir4501 ,hsa mir1823 p) while others had significantly low expression (hsa mIR6255 p ,h samIR1005 p ,h samIR125b5 p ,h samIR1973 p) in peripheral blood samples [PMC4690823].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUGAGUAACCUUUGCUAGUCCUGACUCAGCCAGUACUGGUCUUAGACUGGUGAUGGGUCAGGGUUCAUAUUUUGGCAUCUCUCUCUGGGCAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications