Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila persimilis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5) secondary structure diagram

Drosophila persimilis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5) URS000061EA1A_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGAGUGGCGCAGUGGAAGCGUGCUGGGCCCAUAACCCAGAGGUCCGAGGAUCGAAACCUUGCUCUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Arabis alpina (gray rockcress) tRNA
  2. Bactrocera dorsalis (Oriental fruit fly) tRNA-Met
  3. Bactrocera latifrons tRNA-Met
  4. Bactrocera tryoni tRNA-Met
  5. Ceratitis capitata tRNA-Met
  6. Drosophila ananassae tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1)
  7. Drosophila busckii tRNA
  8. Drosophila erecta tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  9. Drosophila ficusphila tRNA
  10. Drosophila grimshawi tRNA-iMet (CAT) (tRNA-iMet-CAT-2-1, tRNA-iMet-CAT-2-2)
  11. Drosophila guanche tRNA.Met
  12. Drosophila gunungcola tRNA-OTHER
  13. Drosophila melanogaster (fruit fly) transfer RNA:initiator Methionine-CAT 1-2 (Dmel_CR30218, Dmel_CR30452, Dmel_CR32142, Dmel_CR32144, Dmel_CR32482)
  14. Drosophila mojavensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  15. Drosophila pseudoobscura pseudoobscura tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  16. Drosophila sechellia tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  17. Drosophila simulans tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  18. Drosophila virilis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  19. Drosophila willistoni tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  20. Drosophila yakuba tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  21. Glossina austeni (Tsetse fly) tRNA tRNA-Met
  22. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Met
  23. Glossina fuscipes fuscipes tRNA
  24. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Met
  25. Glossina pallidipes (Tsetse fly) tRNA tRNA-Met
  26. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Met
  27. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  28. Lucilia cuprina (Australian sheep blowfly) tRNA-Met for anticodon CAU
  29. Musca domestica tRNA MDOA012754
  30. Nematostella vectensis tRNA-Met for anticodon CAU
  31. Punica granatum tRNA
  32. Rhagoletis pomonella tRNA-Met
  33. Stomoxys calcitrans (Stable fly) tRNA-Met
  34. Thrips palmi tRNA-Met
2D structure Publications