Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-711 URS000061DF98_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-711: Mmu-mir-711 is a microRNA that has been found to be significantly upregulated in certain conditions. In a study comparing Hypo-Exo and Nor-Exo, mmu-mir-711 was one of six miRNAs that showed significant upregulation in Hypo-Exo [PMC6299684]. Another study found that mmu-mir-711, along with other miRNAs, had less weight in the Esrrb miRNA regulation and regulated less than 10 target genes [PMC9149258]. In a comparison of plasma miRNAs between uninfected and infected BALB/c mice, mmu-mir-711 was one of the downregulated miRNAs [PMC9218868]. Mmu-mir-711 has also been implicated in osteogenic differentiation, with its expression being differentially regulated after 3 and 7 days of differentiation [PMC4807979]. Additionally, mmu-mir-711 has been predicted to be involved in cellular response to stimulus [PMC4391475]. In a study on DIO mice, mmu-mir-711 was found to be upregulated in DIO mice but significantly downregulated in DIO + LFD mice [PMC4571067]. However, there have been challenges in quantifying the expression of mmu-mir-711 due to low or undetectable expression levels or technical problems [PMC8648918]. Mmu-mir-711 is mouse-specific and does not have similar sequences in other species such as humans or Chinese hamsters according to miRBase 20 [PMC4139590].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGACCCGGGGAGAGAUGUAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications