Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Helicoverpa zea (Corn earworm) tRNA-Trp secondary structure diagram

Helicoverpa zea (Corn earworm) tRNA-Trp URS000061C9F9_7113

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACUCCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 195 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Trp
  3. Aedes aegypti tRNA AAEL016195
  4. Aedes albopictus tRNA tRNA-Trp
  5. Aethina tumida (Small hive beetle) transfer RNA tryptophan (anticodon CCA)
  6. Agrilus planipennis tRNA-Trp
  7. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011463.1
  8. Amphibalanus amphitrite (Acorn barnacle) tRNA-Trp
  9. Amyelois transitella tRNA-Trp
  10. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000007733.1
  11. Anisakis simplex (herring worm) tRNA
  12. Anneissia japonica (Sea lily) tRNA-Trp
  13. Anopheles albimanus (Mosquito) tRNA tRNA-Trp
  14. Anopheles arabiensis (Mosquito) tRNA tRNA-Trp
  15. Anopheles atroparvus tRNA
  16. Anopheles christyi (Mosquito) tRNA tRNA-Trp
  17. Anopheles coluzzii tRNA-Trp for anticodon CCA
  18. Anopheles culicifacies tRNA tRNA-Trp
  19. Anopheles darlingi tRNA Tryptophan
  20. Anopheles dirus (Mosquito) tRNA tRNA-Trp
  21. Anopheles epiroticus (Mosquito) tRNA tRNA-Trp
  22. Anopheles farauti tRNA tRNA-Trp
  23. Anopheles funestus tRNA-Trp for anticodon CCA
  24. Anopheles gambiae tRNA tRNA-Trp
  25. Anopheles gambiae str. PEST tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 7)
  26. Anopheles maculatus tRNA tRNA-Trp
  27. Anopheles melas (Mosquito) tRNA tRNA-Trp
  28. Anopheles merus (Mosquito) tRNA tRNA-Trp
  29. Anopheles minimus tRNA tRNA-Trp
  30. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Trp
  31. Anopheles sinensis (Mosquito) tRNA tRNA-Trp
  32. Anopheles stephensi tRNA tRNA-Trp
  33. Anthonomus grandis grandis transfer RNA tryptophan (anticodon CCA)
  34. Aphidius gifuensis (Parasitoid wasp) tRNA-Trp
  35. Apis dorsata (Giant honeybee) tRNA-Trp
  36. Apis florea (Dwarf honeybee) tRNA-Trp
  37. Apis mellifera tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  38. Arabis alpina (gray rockcress) tRNA
  39. Aromia moschata tRNA-OTHER
  40. Ascaris lumbricoides tRNA
  41. Ascaris suum (pig roundworm) tRNA
  42. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005006347.1
  43. Atta cephalotes tRNA LOC105616965-2
  44. Atta colombica tRNA
  45. Bactrocera dorsalis (Oriental fruit fly) tRNA-Trp
  46. Bactrocera latifrons tRNA-Trp
  47. Bactrocera tryoni tRNA-Trp
  48. Belgica antarctica tRNA-Trp for anticodon CCA
  49. Bicyclus anynana tRNA-Trp
  50. Blattella germanica tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 7)
  51. Bombus huntii (Hunt's bumblebee) transfer RNA tryptophan (anticodon CCA)
  52. Bombus terrestris tRNA LOC110119595
  53. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Trp
  54. Bombyx mandarina (Wild silkworm) tRNA-Trp
  55. Bombyx mori tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 9)
  56. Brugia malayi tRNA
  57. Brugia pahangi tRNA
  58. Brugia timori tRNA
  59. Callosobruchus analis hypothetical protein
  60. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  61. Camponotus floridanus (Florida carpenter ant) tRNA-Trp
  62. Capitella teleta (Bristle worm) tRNA-Trp for anticodon CCA
  63. Cataglyphis hispanica (Desert ant) transfer RNA tryptophan (anticodon CCA)
  64. Ceratitis capitata tRNA-Trp
  65. Chelonus insularis tRNA-Trp
  66. Cimex lectularius tRNA-Trp
  67. Copidosoma floridanum tRNA-Trp
  68. Cotesia glomerata tRNA-Trp
  69. Cryptotermes secundus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  70. Culex quinquefasciatus tRNA-Trp
  71. Cyphomyrmex costatus tRNA
  72. Danaus plexippus plexippus tRNA
  73. Daphnia galeata transfer RNA
  74. Daphnia magna (Fresh water planktonic) tRNA-Trp
  75. Daphnia pulex tRNA-Trp
  76. Daphnia pulicaria (Water flea) tRNA-Trp
  77. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Trp
  78. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA tryptophan (anticodon CCA)
  79. Dracunculus medinensis tRNA
  80. Drosophila ananassae tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  81. Drosophila busckii tRNA
  82. Drosophila erecta tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  83. Drosophila ficusphila tRNA
  84. Drosophila grimshawi tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 4)
  85. Drosophila guanche tRNA.Trp
  86. Drosophila gunungcola tRNA-OTHER
  87. Drosophila melanogaster (fruit fly) transfer RNA:Tryptophan-CCA 1-1 (Dmel_CR30155, Dmel_CR30211)
  88. Drosophila mojavensis tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 4)
  89. Drosophila persimilis tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 5)
  90. Drosophila pseudoobscura pseudoobscura tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 10)
  91. Drosophila sechellia tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  92. Drosophila simulans tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  93. Drosophila virilis tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 4)
  94. Drosophila willistoni tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 5)
  95. Drosophila yakuba tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  96. Dryococelus australis tRNA-OTHER
  97. Dufourea novaeangliae (Bee) tRNA-Trp
  98. Echinococcus granulosus tRNA
  99. Echinococcus multilocularis tRNA
  100. Eufriesea mexicana (Bee) tRNA-Trp
  101. Eumeta japonica tRNA-Trp
  102. Exocentrus adspersus tRNA-OTHER
  103. Frieseomelitta varia tRNA-Trp
  104. Galleria mellonella (Greater wax moth) tRNA-Trp
  105. Gigantopelta aegis (Deep sea snail) tRNA-Trp
  106. Glossina austeni (Tsetse fly) tRNA tRNA-Trp
  107. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Trp
  108. Glossina fuscipes fuscipes tRNA
  109. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Trp
  110. Glossina pallidipes (Tsetse fly) tRNA tRNA-Trp
  111. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Trp
  112. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014568.1
  113. Gongylonema pulchrum tRNA
  114. Habropoda laboriosa tRNA-Trp
  115. Harpegnathos saltator (Indian jumping ant) tRNA-Trp
  116. Heliconius melpomene tRNA HMEL013912
  117. Helicoverpa armigera transfer RNA tryptophan (anticodon CCA)
  118. Helobdella robusta tRNA-Trp for anticodon CCA
  119. Hermetia illucens tRNA-Trp
  120. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  121. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005005791.1
  122. Lasius niger tRNA
  123. Leguminivora glycinivorella tRNA-Trp
  124. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Trp
  125. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015438.1
  126. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015936.1
  127. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016387.1
  128. Linepithema humile tRNA-Trp
  129. Lingula anatina tRNA-Trp
  130. Loa loa tRNA-Trp for anticodon CCA
  131. Lottia gigantea tRNA-Trp for anticodon CCA
  132. Lucilia cuprina (Australian sheep blowfly) tRNA-Trp for anticodon CCA
  133. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Trp
  134. Manduca sexta (Tobacco hornworm) tRNA-Trp
  135. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Trp
  136. Melipona bicolor tRNA-Trp
  137. Melipona quadrifasciata tRNA
  138. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023679.1
  139. Meloidogyne hapla tRNA
  140. Mizuhopecten yessoensis (Yesso scallop) tRNA-Trp
  141. Mnemiopsis leidyi tRNA-Trp for anticodon CCA
  142. Molorchus minor tRNA-Trp
  143. Monomorium pharaonis (Pharaoh ant) tRNA-Trp
  144. Musca domestica tRNA MDOA001268
  145. Mya arenaria (Soft-shell clam) transfer RNA tryptophan (anticodon CCA)
  146. Nasonia vitripennis tRNA-Trp
  147. Neodiprion lecontei tRNA-Trp
  148. Neodiprion pinetum (White pine sawfly) tRNA-Trp
  149. Onchocerca flexuosa tRNA
  150. Onchocerca volvulus tRNA
  151. Onthophagus taurus tRNA-Trp
  152. Ooceraea biroi tRNA-Trp
  153. Operophtera brumata tRNA
  154. Orussus abietinus (Parasitic wood wasp) tRNA-Trp
  155. Oryctes borbonicus tRNA
  156. Papilio machaon tRNA
  157. Papilio xuthus tRNA
  158. Pararge aegeria tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 10)
  159. Patella pellucida (Blue-rayed limpet) misc RNA ENSDPLG00005026734.1
  160. Patella vulgata (Common limpet) misc RNA ENSPVUG00005027863.1
  161. Pectinophora gossypiella (Pink bollworm) transfer RNA tryptophan (anticodon CCA)
  162. Phlebotomus papatasi (Sand fly) tRNA tRNA-Trp
  163. Plutella xylostella tRNA-Trp
  164. Pogonomyrmex barbatus tRNA-Trp
  165. Polistes canadensis tRNA-Trp
  166. Polistes dominula (European paper wasp) tRNA-Trp
  167. Polistes fuscatus tRNA-Trp
  168. Pollicipes pollicipes (Goose neck barnacle) tRNA-Trp
  169. Pseudomonadota bacterium tRNA-Trp
  170. Punica granatum tRNA
  171. Rhagoletis pomonella tRNA-Trp
  172. Rhamnusium bicolor tRNA-OTHER
  173. Rhodnius prolixus (Kissing bug) tRNA tRNA-Trp
  174. Schistocerca americana (American grasshopper) tRNA-Trp
  175. Schistocerca cancellata (South American locust) transfer RNA tryptophan (anticodon CCA)
  176. Schistocerca gregaria (Grasshoppers) transfer RNA tryptophan (anticodon CCA)
  177. Schistocerca nitens (Vagrant locust) transfer RNA tryptophan (anticodon CCA)
  178. Schistocerca piceifrons (Central American locust) tRNA-Trp
  179. Schistocerca serialis cubense (Grasshoppers) transfer RNA tryptophan (anticodon CCA)
  180. Sitophilus oryzae (Rice weevil) tRNA-Trp
  181. Solenopsis invicta tRNA
  182. Spodoptera frugiperda tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 15)
  183. Stomoxys calcitrans (Stable fly) tRNA-Trp
  184. Thelazia callipaeda tRNA
  185. Thrips palmi tRNA-Trp
  186. Toxocara canis tRNA
  187. Trachymyrmex cornetzi tRNA
  188. Trachymyrmex septentrionalis tRNA
  189. Trachymyrmex zeteki tRNA
  190. Tribolium castaneum tRNA-Trp for anticodon CCA
  191. Trichogramma pretiosum (Parasitoid wasp) tRNA-Trp
  192. Trichomalopsis sarcophagae tRNA
  193. Venturia canescens tRNA-Trp
  194. Wuchereria bancrofti tRNA
  195. Zerene cesonia (Southern Dogface) tRNA-Trp
2D structure Publications