v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila bocki 5.8S ribosomal RNA secondary structure diagram

Drosophila bocki 5.8S ribosomal RNA URS000061394B_103765

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACUCUAAGCGGUGGAUCACUCGGCUCAUGGGUCGAUGAAGAACGCAGCAAACUGUGCGUCAUCGUGUGAACUGCAGGACACAUGAACAUCGACAUUUUGAACGCAUAUCGCAGUCCAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Drosophila leontia 5.8S ribosomal RNA
  2. Drosophila lini 5.8S ribosomal RNA
  3. Drosophila mauritiana 5.8S ribosomal RNA
  4. Drosophila melanogaster (fruit fly) 5.8S ribosomal RNA:CR45839 (Dmel_CR45839, Dmel_CR45842, Dmel_CR45852)
  5. Drosophila ogumai 5.8S ribosomal RNA
  6. Drosophila ohnishii 5.8S ribosomal RNA
  7. Drosophila sechellia 5.8S ribosomal RNA
  8. Drosophila simulans 5.8S ribosomal RNA
  9. Drosophila yakuba 5.8S ribosomal RNA
 2D structure