Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Histidine tRNA (tRNA-His), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Histidine tRNA (tRNA-His), predicted by tRNAscan-SE analysis URS0000612D1D_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (GtRNAdb, SGD, IntAct, ENA, Rfam). Described in 47 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Histidine tRNA (tRNA-His), predicted by tRNAscan-SE analysis sequence is a product of tRNA-His-GTG-1-1, tRNA-His-GTG-1-7, tRNA-His-GTG-1-2, tRNA-His-GTG-1-3, tRNA-His-GTG-1-6, tRNA-His-GTG-1-4, tRNA-His-GTG-1-5 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Histidine tRNA (tRNA-His), predicted by tRNAscan-SE analysis interacts with:

Interaction id Participant Synonyms
EBI-12515947 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast
EBI-12516060 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCAUCUUAGUAUAGUGGUUAGUACACAUCGUUGUGGCCGAUGAAACCCUGGUUCGAUUCUAGGAGAUGGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 142 other species

    1. [Candida] glabrata tRNA-His (GTG) (tRNA-His-GTG-1-1)
    2. Drosophila simulans tRNA-His
    3. Kazachstania africana CBS 2517 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    4. Naumovozyma dairenensis CBS 421 tRNA-His (GTG) (tRNA-His-GTG-1-1, tRNA-His-GTG-1-2)
    5. Saccharomyces arboricola H-6 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    6. Saccharomyces boulardii (nom. inval.) tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    7. Saccharomyces cerevisiae AWRI796 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    8. Saccharomyces cerevisiae tH(GTG)GL1 - systematic name
    9. Saccharomyces cerevisiae CBS 7960 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    10. Saccharomyces cerevisiae CEN.PK113-7D tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    11. Saccharomyces cerevisiae CLIB215 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    12. Saccharomyces cerevisiae CLIB324 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    13. Saccharomyces cerevisiae CLIB382 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 3)
    14. Saccharomyces cerevisiae EC1118 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    15. Saccharomyces cerevisiae EC9-8 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    16. Saccharomyces cerevisiae FL100 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    17. Saccharomyces cerevisiae FostersB tRNA-His (GTG) (tRNA-His-GTG-1 1 to 4)
    18. Saccharomyces cerevisiae FostersO tRNA
    19. Saccharomyces cerevisiae Kyokai no. 7 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    20. Saccharomyces cerevisiae Lalvin QA23 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    21. Saccharomyces cerevisiae P283 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    22. Saccharomyces cerevisiae P301 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 4)
    23. Saccharomyces cerevisiae PE-2 tRNA-His
    24. Saccharomyces cerevisiae PW5 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 3)
    25. Saccharomyces cerevisiae R008 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    26. Saccharomyces cerevisiae R103 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
    27. Saccharomyces cerevisiae RM11-1a tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    28. Saccharomyces cerevisiae Sigma1278b tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    29. Saccharomyces cerevisiae T73 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 4)
    30. Saccharomyces cerevisiae T7 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    31. Saccharomyces cerevisiae UC5 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 4)
    32. Saccharomyces cerevisiae UFMG A-905 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 8)
    33. Saccharomyces cerevisiae Vin13 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    34. Saccharomyces cerevisiae VL3 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    35. Saccharomyces cerevisiae W303 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    36. Saccharomyces cerevisiae Y10 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 6)
    37. Saccharomyces cerevisiae YJM1078 tRNA-His
    38. Saccharomyces cerevisiae YJM1083 tRNA-His
    39. Saccharomyces cerevisiae YJM1129 tRNA-His
    40. Saccharomyces cerevisiae YJM1133 tRNA-His
    41. Saccharomyces cerevisiae YJM1190 tRNA-His
    42. Saccharomyces cerevisiae YJM1199 tRNA-His
    43. Saccharomyces cerevisiae YJM1202 tRNA-His
    44. Saccharomyces cerevisiae YJM1208 tRNA-His
    45. Saccharomyces cerevisiae YJM1242 tRNA-His
    46. Saccharomyces cerevisiae YJM1244 tRNA-His
    47. Saccharomyces cerevisiae YJM1248 tRNA-His
    48. Saccharomyces cerevisiae YJM1250 tRNA-His
    49. Saccharomyces cerevisiae YJM1252 tRNA-His
    50. Saccharomyces cerevisiae YJM1273 tRNA-His
    51. Saccharomyces cerevisiae YJM1304 tRNA-His
    52. Saccharomyces cerevisiae YJM1307 tRNA-His
    53. Saccharomyces cerevisiae YJM1311 tRNA-His
    54. Saccharomyces cerevisiae YJM1326 tRNA-His
    55. Saccharomyces cerevisiae YJM1332 tRNA-His
    56. Saccharomyces cerevisiae YJM1336 tRNA-His
    57. Saccharomyces cerevisiae YJM1338 tRNA-His
    58. Saccharomyces cerevisiae YJM1341 tRNA-His
    59. Saccharomyces cerevisiae YJM1342 tRNA-His
    60. Saccharomyces cerevisiae YJM1355 tRNA-His
    61. Saccharomyces cerevisiae YJM1356 tRNA-His
    62. Saccharomyces cerevisiae YJM1381 tRNA-His
    63. Saccharomyces cerevisiae YJM1383 tRNA-His
    64. Saccharomyces cerevisiae YJM1385 tRNA-His
    65. Saccharomyces cerevisiae YJM1386 tRNA-His
    66. Saccharomyces cerevisiae YJM1387 tRNA-His
    67. Saccharomyces cerevisiae YJM1388 tRNA-His
    68. Saccharomyces cerevisiae YJM1389 tRNA-His
    69. Saccharomyces cerevisiae YJM1399 tRNA-His
    70. Saccharomyces cerevisiae YJM1400 tRNA-His
    71. Saccharomyces cerevisiae YJM1401 tRNA-His
    72. Saccharomyces cerevisiae YJM1402 tRNA-His
    73. Saccharomyces cerevisiae YJM1415 tRNA-His
    74. Saccharomyces cerevisiae YJM1417 tRNA-His
    75. Saccharomyces cerevisiae YJM1418 tRNA-His
    76. Saccharomyces cerevisiae YJM1419 tRNA-His
    77. Saccharomyces cerevisiae YJM1433 tRNA-His
    78. Saccharomyces cerevisiae YJM1434 tRNA-His
    79. Saccharomyces cerevisiae YJM1439 tRNA-His
    80. Saccharomyces cerevisiae YJM1443 tRNA-His
    81. Saccharomyces cerevisiae YJM1444 tRNA-His
    82. Saccharomyces cerevisiae YJM1447 tRNA-His
    83. Saccharomyces cerevisiae YJM1450 tRNA-His
    84. Saccharomyces cerevisiae YJM1460 tRNA-His
    85. Saccharomyces cerevisiae YJM1463 tRNA-His
    86. Saccharomyces cerevisiae YJM1477 tRNA-His
    87. Saccharomyces cerevisiae YJM1478 tRNA-His
    88. Saccharomyces cerevisiae YJM1479 tRNA-His
    89. Saccharomyces cerevisiae YJM1526 tRNA-His
    90. Saccharomyces cerevisiae YJM1527 tRNA-His
    91. Saccharomyces cerevisiae YJM1549 tRNA-His
    92. Saccharomyces cerevisiae YJM1573 tRNA-His
    93. Saccharomyces cerevisiae YJM1574 tRNA-His
    94. Saccharomyces cerevisiae YJM1592 tRNA-His
    95. Saccharomyces cerevisiae YJM1615 tRNA-His
    96. Saccharomyces cerevisiae YJM189 tRNA-His
    97. Saccharomyces cerevisiae YJM193 tRNA-His
    98. Saccharomyces cerevisiae YJM195 tRNA-His
    99. Saccharomyces cerevisiae YJM244 tRNA-His
    100. Saccharomyces cerevisiae YJM248 tRNA-His
    101. Saccharomyces cerevisiae YJM269 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    102. Saccharomyces cerevisiae YJM270 tRNA-His
    103. Saccharomyces cerevisiae YJM271 tRNA-His
    104. Saccharomyces cerevisiae YJM320 tRNA-His
    105. Saccharomyces cerevisiae YJM326 tRNA-His
    106. Saccharomyces cerevisiae YJM428 tRNA-His
    107. Saccharomyces cerevisiae YJM450 tRNA-His
    108. Saccharomyces cerevisiae YJM451 tRNA-His
    109. Saccharomyces cerevisiae YJM453 tRNA-His
    110. Saccharomyces cerevisiae YJM456 tRNA-His
    111. Saccharomyces cerevisiae YJM470 tRNA-His
    112. Saccharomyces cerevisiae YJM541 tRNA-His
    113. Saccharomyces cerevisiae YJM554 tRNA-His
    114. Saccharomyces cerevisiae YJM555 tRNA-His
    115. Saccharomyces cerevisiae YJM627 tRNA-His
    116. Saccharomyces cerevisiae YJM681 tRNA-His
    117. Saccharomyces cerevisiae YJM682 tRNA-His
    118. Saccharomyces cerevisiae YJM683 tRNA-His
    119. Saccharomyces cerevisiae YJM689 tRNA-His
    120. Saccharomyces cerevisiae YJM693 tRNA-His
    121. Saccharomyces cerevisiae YJM969 tRNA-His
    122. Saccharomyces cerevisiae YJM972 tRNA-His
    123. Saccharomyces cerevisiae YJM975 tRNA-His
    124. Saccharomyces cerevisiae YJM978 tRNA-His
    125. Saccharomyces cerevisiae YJM981 tRNA-His
    126. Saccharomyces cerevisiae YJM984 tRNA-His
    127. Saccharomyces cerevisiae YJM987 tRNA-His
    128. Saccharomyces cerevisiae YJM990 tRNA-His
    129. Saccharomyces cerevisiae YJM993 tRNA-His
    130. Saccharomyces cerevisiae YJM996 tRNA-His
    131. Saccharomyces cerevisiae YJSH1 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    132. Saccharomyces kudriavzevii IFO 1802 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    133. Saccharomyces pastorianus tRNA-His
    134. Tetrapisispora blattae CBS 6284 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 7)
    135. Tetrapisispora phaffii CBS 4417 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
    136. Vanderwaltozyma polyspora DSM 70294 tRNA-His (GTG) (tRNA-His-GTG-1 1 to 5)
    2D structure New