Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Centruroides sculpturatus (bark scorpion) Csc-Bantam-P16_3p (mature (guide)) URS00006116AC_218467

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUCAUUGUGAAAGCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Apis mellifera (honey bee) ame-bantam-3p
  2. Blattella germanica Bge-Bantam_3p (mature (guide))
  3. Daphnia magna Dma-Bantam_3p (mature (guide))
  4. Daphnia pulex (common water flea) dpu-bantam
  5. Dinoponera quadriceps dqu-bantam-3p
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-1142084
  7. Hyalella azteca miR-81
  8. Ixodes ricinus (castor bean tick) iri-miR-bantam-3p
  9. Ixodes scapularis (black-legged tick) isc-bantam
  10. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Bantam-P10_3p (mature (guide))
  11. Nasonia vitripennis nvi-bantam
  12. Parasteatoda tepidariorum (common house spider) pte-bantam-3p
  13. Tribolium castaneum (red flour beetle) tca-bantam-3p
  14. Triops cancriformis tcf-bantam