Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii tRNA-Ile (AAT) (tRNA-Ile-AAT-3 1 to 5, tRNA-Ile-AAT-3-7) secondary structure diagram

Pongo abelii tRNA-Ile (AAT) (tRNA-Ile-AAT-3 1 to 5, tRNA-Ile-AAT-3-7) URS0000610FFE_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCGGUUAGCUCAGUUGGUUAGAGCGUGGUGCUAAUAACGCCAAGGUCGCGGGUUCGAUCCCCGUACGGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 147 other species

  1. Acanthisitta chloris tRNA
  2. Acinetobacter baumannii tRNA-Ile
  3. Ailuropoda melanoleuca tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  4. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  5. Albula goreensis tRNA-Ile
  6. Alligator mississippiensis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 3)
  7. Alligator sinensis tRNA
  8. Alosa alosa (allis shad) tRNA-Ile
  9. Amazona aestiva tRNA
  10. Ameiurus melas tRNA-Ile
  11. Anas platyrhynchos tRNA
  12. Anguilla anguilla (European eel) tRNA-Ile
  13. Anolis carolinensis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  14. Apaloderma vittatum tRNA
  15. Aptenodytes forsteri (emperor penguin) tRNA
  16. Astyanax mexicanus (Mexican tetra) tRNA
  17. Ataeniobius toweri tRNA-Ile
  18. Balaenoptera acutorostrata scammoni tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 4)
  19. Bos taurus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 16)
  20. Callipepla squamata (scaled quail) tRNA
  21. Callithrix jacchus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  22. Callorhinchus milii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  23. Calypte anna (Anna's hummingbird) tRNA
  24. Camelus ferus tRNA
  25. Canis lupus familiaris tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 5)
  26. Cariama cristata tRNA
  27. Carlito syrichta tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  28. Cavia porcellus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  29. Ceratotherium simum simum tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 8)
  30. Chaetura pelagica (chimney swift) tRNA
  31. Characodon lateralis tRNA-Ile
  32. Charadrius vociferus tRNA
  33. Chelonia mydas tRNA
  34. Chelydra serpentina tRNA-Ile
  35. Chlamydotis macqueenii tRNA
  36. Chlorocebus sabaeus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  37. Choloepus hoffmanni tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  38. Chrysemys picta bellii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 3)
  39. Colinus virginianus (northern bobwhite) tRNA
  40. Colius striatus tRNA
  41. Columba livia tRNA
  42. Crenichthys baileyi tRNA-Ile
  43. Cricetulus griseus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 12)
  44. Cuculus canorus (common cuckoo) tRNA
  45. Danio rerio tRNA-Ile (AAT) (tRNA-Ile-AAT-2-1)
  46. Dasypus novemcinctus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  47. Dipodomys ordii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  48. Echinops telfairi tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  49. Equus caballus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 14)
  50. Erinaceus europaeus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  51. Eschrichtius robustus tRNA-Ile
  52. Eurypyga helias (sunbittern) tRNA
  53. Felis catus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 10)
  54. Ficedula albicollis tRNA
  55. Fukomys damarensis (Damara mole-rat) tRNA
  56. Gallus gallus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  57. Gavia stellata tRNA
  58. Geospiza fortis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  59. Gorilla gorilla gorilla tRNA-Ile (AAT) (tRNA-Ile-AAT-3 1 to 6)
  60. Haliaeetus albicilla tRNA
  61. Heterocephalus glaber tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  62. Homo sapiens tRNA-Ile (anticodon AAT) 5-1 (TRI-AAT5 1 to 5)
  63. Ictidomys tridecemlineatus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  64. Lamprotornis superbus tRNA-OTHER
  65. Larimichthys crocea tRNA
  66. Latimeria chalumnae tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1, tRNA-Ile-AAT-1-2)
  67. Lepisosteus oculatus tRNA
  68. Leptosomus discolor tRNA
  69. Lonchura striata domestica (Bengalese finch) tRNA
  70. Loxodonta africana tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  71. Macaca mulatta tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  72. Manacus vitellinus (golden-collared manakin) tRNA
  73. Marmota monax (woodchuck) tRNA.Ile
  74. Megalops atlanticus (tarpon) tRNA-Ile
  75. Meleagris gallopavo tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  76. Melopsittacus undulatus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 4)
  77. Merops nubicus tRNA
  78. Mesitornis unicolor (brown roatelo) tRNA
  79. Mesocricetus auratus tRNA
  80. Microcebus murinus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  81. Monodelphis domestica tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 13)
  82. Mus caroli tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  83. Mus musculus castaneus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  84. Mus musculus domesticus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  85. Mus musculus musculus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  86. Mus musculus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  87. Mus pahari tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  88. Mus spretus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  89. Mustela putorius furo tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  90. Myotis brandtii tRNA
  91. Myotis davidii tRNA
  92. Myotis lucifugus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  93. Neotoma lepida tRNA
  94. Nestor notabilis tRNA
  95. Nipponia nippon tRNA
  96. Nomascus leucogenys tRNA-Ile (AAT) (tRNA-Ile-AAT-4 1 to 4)
  97. Notamacropus eugenii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  98. Nothobranchius furzeri tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  99. Ochotona princeps tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  100. Ophiophagus hannah (king cobra) tRNA
  101. Opisthocomus hoazin tRNA
  102. Oreochromis niloticus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 13)
  103. Ornithorhynchus anatinus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 10)
  104. Oryctolagus cuniculus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  105. Oryzias latipes tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
  106. Otolemur garnettii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  107. Ovis aries tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 10)
  108. Pangasianodon gigas tRNA-Ile
  109. Pangasianodon hypophthalmus tRNA-Ile
  110. Pangasius djambal tRNA-Ile
  111. Pan troglodytes tRNA-Ile (AAT) (tRNA-Ile-AAT-4 1 to 7)
  112. Papio anubis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  113. Patagioenas fasciata monilis tRNA
  114. Pelecanus crispus tRNA
  115. Pelobates cultripes (western spadefoot toad) tRNA.Ile
  116. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  117. Perca flavescens (yellow perch) tRNA-Ile
  118. Perca fluviatilis tRNA-Ile
  119. Petromyzon marinus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 3)
  120. Phaethon lepturus tRNA
  121. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  122. Dryobates pubescens tRNA
  123. Podarcis lilfordi tRNA.Ile
  124. Poecilia formosa tRNA
  125. Procavia capensis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 10)
  126. Pterocles gutturalis tRNA
  127. Pteropus alecto tRNA
  128. Rattus norvegicus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  129. Saimiri boliviensis boliviensis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 7)
  130. Sarcophilus harrisii tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 11)
  131. Scleropages formosus (Asian bonytongue) tRNA
  132. Sorex araneus tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
  133. Sphaerodactylus townsendi tRNA-Ile
  134. Struthio camelus australis tRNA
  135. Sus scrofa tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 12)
  136. Taeniopygia guttata tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 4)
  137. Takifugu rubripes tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 10)
  138. Tauraco erythrolophus (red-crested turaco) tRNA
  139. Tetraodon nigroviridis tRNA
  140. Tinamus guttatus tRNA
  141. Trichechus manatus latirostris tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
  142. Tupaia chinensis tRNA
  143. Tursiops truncatus tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 6)
  144. Vicugna pacos tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
  145. Xenopus laevis (African clawed frog) tRNA
  146. Xenopus tropicalis tRNA-Ile (AAT) (tRNA-Ile-AAT-2 1 to 71)
  147. Xiphophorus maculatus (southern platyfish) tRNA
2D structure Publications