Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-iab-4-5p URS0000610AD7_7159

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGUAUACUGAAUGUAUCCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-iab-4
  2. Apis mellifera (honey bee) ame-miR-iab-4-5p
  3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-iab-4
  4. Blattella germanica Bge-Iab-4_5p (mature (guide))
  5. Bombyx mori (domestic silkworm) bmo-miR-iab-4-5p
  6. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-iab-4-5p
  7. Cochliomyia macellaria mature cma-miR-iab-4-5p
  8. Culex quinquefasciatus (southern house mosquito) cqu-miR-iab-4
  9. Daphnia magna Dma-Iab-4_5p (mature (guide))
  10. Daphnia pulex (common water flea) dpu-miR-iab-4-5p
  11. Dinoponera quadriceps dqu-iab-4-5p
  12. Drosophila ananassae dan-miR-iab-4-5p
  13. Drosophila erecta der-miR-iab-4-5p
  14. Drosophila grimshawi dgr-miR-iab-4-5p
  15. Drosophila melanogaster (fruit fly) dme-miR-iab-4-5p
  16. Drosophila mojavensis dmo-miR-iab-4-5p
  17. Drosophila persimilis dpe-miR-iab-4-5p
  18. Drosophila pseudoobscura dps-miR-iab-4-5p
  19. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294397_df_nrg
  20. Drosophila sechellia dse-miR-iab-4-5p
  21. Drosophila simulans dsi-miR-iab-4-5p
  22. Drosophila virilis dvi-miR-iab-4-5p
  23. Drosophila willistoni dwi-miR-iab-4-5p
  24. Drosophila yakuba dya-miR-iab-4-5p
  25. Heliconius melpomene Hme-Iab-4_5p (mature (guide))
  26. Manduca sexta (tobacco hornworm) mse-miR-iab-4-5p
  27. Nasonia giraulti ngi-miR-iab-4
  28. Polistes canadensis pca-iab-4-5p
  29. Tribolium castaneum (red flour beetle) tca-miR-iab-4-5p
  30. Triops cancriformis tcf-miR-iab-4
Publications