Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3197 URS000060FA45_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3197: Hsa-mir-3197 is a microRNA (miRNA) that has been identified in various studies. It has been found to be one of the microRNAs regulated by hsa_circRNA_000957 and hsa_circRNA_101798, with 29 and 4 related target genes, respectively [PMC9451056]. The expression of hsa-mir-3197 has been evaluated in different contexts. For example, it was found to be significantly downregulated in the plasma of patients with COVID-19 [PMC9346380]. In patients with autism spectrum disorder (ASD), hsa-mir-3197 was identified as one of the top three downregulated miRNAs [PMC9000903]. Hsa-mir-3197 was also evaluated as one of the miRNAs encoded by chromosome 21 [PMC5863254]. Additionally, it has been regulated by TNFRSF13C and associated with intrahepatic cholangiocarcinoma [PMC7679428] [PMC7257878]. The expression levels of hsa-mir-3197 have also been found to be altered in different conditions. For example, it was downregulated by L. crispatus and upregulated in patients with intrahepatic cholangiocarcinoma [PMC10054151] [PMC7257878]. Hsa-mir-3197 is among the miRNAs associated with overall survival in patients with intrahepatic cholangiocarcinoma [PMC7257878]. It is worth noting that hsa-mir-3197 is just one among several miRNAs that have been identified and studied in various contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGGCGCAGGCUCGGAAAGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications