Drosophila simulans Small nucleolar RNA Z5

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila simulans Small nucleolar RNA Z5 URS000060C337_7240

113 nucleotides
2 databases (ENA, Rfam)
Found in 2 other species
1 publications
1. sncRNA
2. snoRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUCAAAUGAUGAAACAGAUGACGAGACUGAAGGAACAAAUUCUCGACUUGGCGCUGUAUUUUUCAGUGCCUCGUUAUAUAUUUGUUCAUUUAAGAUGAUUCGGCGAUCUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Drosophila melanogaster (fruit fly) snoRNA:Me18S-A1576 (Dmel_CR31877)
Drosophila sechellia snoRNA Dsec\snoRNA:GM27563

Publications