Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR408-5p URS000060700E_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR408-5p: Osa-mir408-5p is a regulatory microRNA that has been studied in various contexts. It has been found to be positively correlated with the expression of a predicted target gene LOC_Os12g40890 (PCC = 0.464) [PMC7071783]. Osa-mir408-5p is one of the six common differentially expressed miRNAs (DEmiRNAs) found in both cultivars, with osa-miR166-5p showing a different expression pattern [PMC7003353]. It has been observed that osa-mir408-5p is up-regulated by Cd treatment [PMC7003353]. In drought-susceptible rice varieties, osa-mir408-5p has been found to be up-regulated [PMC7003353]. Osa-mir408-5p, along with other miRNAs such as osa-miR396 and osa-miR444, have been shown to be highly up-regulated in one rice variety compared to another under different conditions [PMC7226372]. Osa-mir408-5p targets the subfamily member OsHDZIP37 and is also targeted by other miRNA families such as osa-miR5832 and osa-miR1883b [PMC9405480]. The expression levels of osa-mir408-5p have been found to be higher in drought-tolerant rice varieties compared to drought-susceptible varieties under drought-free conditions [PMC4570225]. In leaf tissue, the expression of osa-mir408-5p was down-regulated in some drought-tolerant varieties but up-regulated in a drought-susceptible variety under drought stress conditions [PMC4570225]. Osa-mir408-5p has also been found to be significantly upregulated by chilling stress [PMC9002458].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGGAUGAGGCAGAGCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR408-5p
Publications