Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1460 SNR36 secondary structure diagram

Saccharomyces cerevisiae YJM1460 SNR36 URS0000604143_1294377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCCCUGUGCCUCGCUCGGUUGUUAAUUGCCAAUAUUACGAUCUUGAGCUGGAUGACAAAAAAAUAAAAAUACAUUUUAUUUUUUUGAUCAACGGGCUAAAACAAUUAGACUUCUUUGAGUACGAGGAUAUCGCUAUUUUUAUCUCACGGUAUCGUAUUGUAAUUAGAACGUCUCAUAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Saccharomyces cerevisiae (baker's yeast) Small nucleolar RNA snR36
  2. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR36
  3. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  4. Saccharomyces cerevisiae YJM1083 SNR36
  5. Saccharomyces cerevisiae YJM1307 SNR36
  6. Saccharomyces cerevisiae YJM1311 SNR36
  7. Saccharomyces cerevisiae YJM1387 SNR36
  8. Saccharomyces cerevisiae YJM1388 SNR36
  9. Saccharomyces cerevisiae YJM1389 SNR36
  10. Saccharomyces cerevisiae YJM1433 SNR36
  11. Saccharomyces cerevisiae YJM1478 SNR36
  12. Saccharomyces cerevisiae YJM1549 SNR36
  13. Saccharomyces cerevisiae YJM1592 SNR36
  14. Saccharomyces cerevisiae YJM326 SNR36
  15. Saccharomyces cerevisiae YJM682 SNR36
2D structure