Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) Aae-Mir-276-P1_3p (mature (guide)) URS0000602386_7159

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGAACUUCAUACCGUGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-276
  2. Anopheles gambiae (African malaria mosquito) aga-miR-276-3p
  3. Apis mellifera ame-miR-276-3p
  4. Bactrocera dorsalis bdo-miR-276a
  5. Blattella germanica (German cockroach) Bge-Mir-276_3p (mature (guide))
  6. Bombyx mori bmo-miR-276-3p
  7. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-276a-3p
  8. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-276a-3p
  9. Culex quinquefasciatus cqu-miR-276-3p
  10. Daphnia magna Dma-Mir-276_3p (mature (guide))
  11. Daphnia pulex (common water flea) dpu-miR-276
  12. Dinoponera quadriceps dqu-miR-276-3p
  13. Drosophila ananassae dan-miR-276a
  14. Drosophila erecta der-miR-276a
  15. Drosophila grimshawi dgr-miR-276a-3p
  16. Drosophila melanogaster dme-miR-276a-3p
  17. Drosophila mojavensis dmo-miR-276a
  18. Drosophila persimilis dpe-miR-276a
  19. Drosophila pseudoobscura dps-miR-276a
  20. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294515_df_nrg
  21. Drosophila sechellia dse-miR-276a
  22. Drosophila simulans dsi-miR-276a
  23. Drosophila virilis dvi-miR-276a-3p
  24. Drosophila willistoni dwi-miR-276a-3p
  25. Drosophila yakuba dya-miR-276a
  26. Heliconius melpomene (postman butterfly) Hme-Mir-276_3p (mature (guide))
  27. Locusta migratoria lmi-miR-276-3p
  28. Manduca sexta (tobacco hornworm) mse-miR-276
  29. Nasonia giraulti ngi-miR-276
  30. Nasonia longicornis nlo-miR-276
  31. Nasonia vitripennis nvi-miR-276
  32. Penaeus japonicus miR-276
  33. Tribolium castaneum tca-miR-276-3p
  34. Triops cancriformis tcf-miR-276-3p