Automated summary: This snoRNA sequence is 50 nucleotides long and is found in Pyrobaculum arsenaticum DSM 13514. Annotated by 1 database (snoRNA Database). Pyrobaculum arsenaticum DSM 13514 PARsR112 sequence is a product of PARsR112 gene.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUGAAGAUAACUAACCCAUCUGAUUGCAUGAAGAAGGGGUCAGGGACUGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.