Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila yakuba microRNA dya-mir-14 precursor secondary structure diagram

Drosophila yakuba microRNA dya-mir-14 precursor URS00005F206D_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGGGAGCGAGACGGGGACUCACUGUGCUUAUUAAAUAGUCAGUCUUUUUCUCUCUCCUAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Drosophila ananassae microRNA dan-mir-14 precursor
  2. Drosophila erecta microRNA der-mir-14 precursor
  3. Drosophila ficusphila microRNA mir-14
  4. Drosophila gunungcola microRNA mir-14
  5. Drosophila melanogaster microRNA dme-mir-14 precursor
  6. Drosophila rhopaloa microRNA mir-14
  7. Drosophila sechellia microRNA dse-mir-14 precursor
  8. Drosophila simulans microRNA dsi-mir-14 precursor
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications