Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cebus imitator (Panamanian white-faced capuchin) microRNA let-7a-1 (ENSCCAG00000005244.1) URS00005EB5B7_2715852

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002894.1)
  2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
  3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
  4. Capra hircus (Goat) microRNA let-7a-1 (ENSCHIG00000009519.1)
  5. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000021072.2)
  6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010054.1)
  7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1)
  8. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021920.1)
  9. Gorilla gorilla gorilla microRNA let-7a-1 (ENSGGOG00000030966.2)
  10. Gorilla gorilla precursor microRNA let-7a-1
  11. Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1)
  12. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7a-1
  13. Lemur catta precursor microRNA let-7a-1
  14. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
  15. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000010971.1)
  16. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004753.1)
  17. Microcebus murinus microRNA let-7a-1 (ENSMICG00000019650.3)
  18. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000018054.1)
  19. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
  20. Oryctolagus cuniculus (rabbit) ocu-let-7a-1 (ENSOCUG00000018323.1)
  21. Pan paniscus microRNA let-7a-1 (ENSPPAG00000007576.1)
  22. Panthera pardus microRNA let-7a-1 (ENSPPRG00000013995.1)
  23. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002647.1)
  24. Pan troglodytes ptr-let-7a-1 (ENSPTRG00000027844.4)
  25. Pongo abelii (Sumatran orangutan) miRNA
  26. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
  27. Propithecus coquereli miRNA (ENSPCOG00000011738.1)
  28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025480.1)
  29. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
  30. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000024057.1)
  31. Saguinus labiatus precursor microRNA let-7a-1
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1)
  33. Sorex araneus (European shrew) miRNA (ENSSARG00000016564.1)
  34. Suricata suricatta (meerkat) microRNA let-7a-1 (ENSSSUG00005021949.1)
  35. Tursiops truncatus miRNA (ENSTTRG00000022643.1)
  36. Vicugna pacos miRNA (ENSVPAG00000016957.1)
Publications