Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bactrocera latifrons (Solanum fruit fly) tRNA-Leu secondary structure diagram

Bactrocera latifrons (Solanum fruit fly) tRNA-Leu URS00005EAB8C_174628

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGGAUGGCCGAGUGGUCUAAGGCGCUGCGUUCAGGUCGCAGUCUACUCUGUAGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Aethina tumida (Small hive beetle) transfer RNA leucine (anticodon CAG)
  2. Bactrocera dorsalis (Oriental fruit fly) tRNA-Leu
  3. Bactrocera tryoni (Queensland fruitfly) tRNA-Leu
  4. Caerostris darwini tRNA-Leu
  5. Ceratitis capitata (Mediterranean fruit fly) tRNA-Leu
  6. Drosophila ananassae tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 10)
  7. Drosophila busckii tRNA
  8. Drosophila buzzatii tRNA-Leu
  9. Drosophila erecta tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 7)
  10. Drosophila ficusphila tRNA
  11. Drosophila grimshawi tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 6)
  12. Drosophila gunungcola tRNA-OTHER
  13. Drosophila melanogaster transfer RNA:Leucine-CAG 1-1 (Dmel_CR30292, Dmel_CR32358-32363, Dmel_CR32456)
  14. Drosophila mojavensis tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 6)
  15. Drosophila sechellia tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 8)
  16. Drosophila simulans tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 8)
  17. Drosophila virilis tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 7)
  18. Drosophila willistoni tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 8)
  19. Drosophila yakuba tRNA-Leu (CAG) (tRNA-Leu-CAG-1 1 to 8)
  20. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Leu
  21. Glossina fuscipes fuscipes tRNA
  22. Glossina palpalis gambiensis tRNA tRNA-Leu
  23. Lucilia cuprina (Australian sheep blowfly) tRNA-Leu for anticodon CAG
  24. Musca domestica tRNA MDOA010889
  25. Rhagoletis pomonella (Apple magot fly) tRNA-Leu
  26. Stomoxys calcitrans (Stable fly) tRNA-Leu
2D structure