Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4270 URS00005E80AD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4270: The expression of hsa-mir-4270 was found to be the most affected by hsa_circ_0005556 [PMC7521983]. However, there were no concordant patterns between qRT-PCR and microarrays for hsa-mir-4270 [PMC4658123]. Hsa-mir-4270, along with other miRNAs such as hsa-miR-4462, hsa-miR-3622b-5p, hsa-miR-6088, and hsa-miR-3934-5p, were found to be involved in ADM [PMC9978013]. Hsa-mir-4270 was also identified as a potential Exo-miRNA [PMC8104147]. Hsa-mir-4270 was significantly upregulated in patients' samples compared to controls and may have a role in cancer stage [PMC4867432]. Hsa-mir-4270 was predicted to be a common regulator of ACE, ACE2, and TMPRSS2 in the context of SARS-CoV-2 infection [PMC9511898]. Hsa-mir-4270 was among the circulating miRNAs identified in breast cancer patients [PMC8573223]. In sepsis-induced AKI groups, hsa-mir 4270 was upregulated while miRNAs such as hsa-miR 142 5p and hsa miR 22 3p were downregulated compared to healthy controls [PMC5351858]. HSA mir 4270 along with other miRNAs were found to target BCAS4 and SHISA7 genes associated with AD-related neurofibrillary pathology [PMC8899724]. In leiomyoma compared to myometrium samples, mir 4270 expression levels were downregulated [PMC9154092].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGGAGUCAGGGGAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications