Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-376-P4_3p (mature (guide)) URS00005E651E_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUAGAGGAAAUUCCACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Canis lupus familiaris (dog) Cfa-Mir-376-P4_3p (mature (guide))
  2. Capra hircus (goat) chi-miR-376c-3p
  3. Cervus elaphus (red deer) cel-miR-376c-3p
  4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-376-P4_3p (mature (guide))
  5. Equus caballus (horse) eca-miR-376c
  6. Homo sapiens (human) hsa-miR-376c-3p
  7. Macaca mulatta (Rhesus monkey) mml-miR-376c-3p
  8. Ovis aries oar-miR-376c-3p
  9. Pan paniscus ppa-miR-376c
  10. Pan troglodytes ptr-miR-376c
  11. Pongo pygmaeus ppy-miR-376c
  12. Tupaia chinensis tch-miR-376c-3p