Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-193a-3p URS00005DBAF3_10116

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Rattus norvegicus. Annotated by 3 databases (RefSeq, miRBase, MirGeneDB). Rattus norvegicus (Norway rat) rno-miR-193a-3p sequence is a product of Mir193, miR-193a, rno-miR-193a, rno-miR-193a-3p, miR-193a-3p, miR-193 genes. Found in the Rattus norvegicus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACUGGCCUACAAAGUCCCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Alligator mississippiensis Ami-Mir-193-P1b_3p (mature (co-guide))
    2. Anolis carolinensis Aca-Mir-193-P1a_3p* (star (passenger))
    3. Bos taurus (cattle) bta-miR-193a-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-193-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-193a-3p
    6. Chrysemys picta bellii Cpi-Mir-193-P1a_3p* (star (passenger))
    7. Cricetulus griseus (Chinese hamster) cgr-miR-193a
    8. Cyprinus carpio ccr-miR-193a
    9. Danio rerio (zebrafish) dre-miR-193a-3p
    10. Dasypus novemcinctus dno-miR-193a-3p
    11. Echinops telfairi Ete-Mir-193-P1b_3p (mature (guide))
    12. Eptesicus fuscus efu-miR-193a
    13. Equus caballus eca-miR-193a-3p
    14. Gadus morhua Gmo-Mir-193-P1b2_3p (mature (guide))
    15. Gallus gallus (chicken) gga-miR-193a-3p
    16. Gekko japonicus Gja-Mir-193-P1b_3p (mature (guide))
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-193-3p
    18. Homo sapiens hsa-miR-193a-3p
    19. Latimeria chalumnae (coelacanth) Lch-Mir-193-P1b_3p (mature (guide))
    20. Macaca mulatta mml-miR-193a-3p
    21. Maylandia zebra mze-miR-193
    22. Microcaecilia unicolor Mun-Mir-193-P1b_3p (mature (guide))
    23. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-193-P1a_3p* (star (passenger))
    24. Monopterus albus (swamp eel) Mal-Mir-193-P1b2_3p (mature (guide))
    25. Mus musculus (house mouse) mmu-miR-193a-3p
    26. Neolamprologus brichardi nbr-miR-193
    27. Ophiophagus hannah (king cobra) oha-miR-193-3p
    28. Oreochromis niloticus (Nile tilapia) oni-miR-193
    29. Oryctolagus cuniculus (rabbit) ocu-miR-193a-3p
    30. Otolemur garnettii oga-miR-193a
    31. Pan paniscus ppa-miR-193a
    32. Pan troglodytes ptr-miR-193a
    33. Papio hamadryas (hamadryas baboon) pha-miR-193a
    34. Pongo pygmaeus (Bornean orangutan) ppy-miR-193a-3p
    35. Pteropus alecto (black flying fox) pal-miR-193a-3p
    36. Python bivittatus pbv-miR-193a-3p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-193-P1a_3p* (star (passenger))
    38. Sus scrofa (pig) ssc-miR-193a-3p
    39. Taeniopygia guttata Tgu-Mir-193-P1b_3p (mature (guide))
    40. Takifugu rubripes fru-miR-193
    41. Tetraodon nigroviridis tni-miR-193
    42. Tor tambroides (Thai mahseer) miR-193a-3p
    43. Tupaia chinensis tch-miR-193a-3p
    Publications