Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Neodiprion pinetum (White pine sawfly) tRNA-Pro secondary structure diagram

Neodiprion pinetum (White pine sawfly) tRNA-Pro URS00005DB87D_441929

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 251 other species

  1. Acanthisitta chloris tRNA
  2. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Pro
  3. Ailuropoda melanoleuca tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  4. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  5. Albula goreensis tRNA-Pro
  6. Alligator mississippiensis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4)
  7. Alligator sinensis (Chinese alligator) tRNA
  8. Alosa alosa tRNA-Pro
  9. Amazona aestiva tRNA
  10. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011459.1
  11. Ameiurus melas tRNA-Pro
  12. Amphibalanus amphitrite tRNA-Pro
  13. Anas platyrhynchos tRNA
  14. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000008978.1
  15. Anguilla anguilla tRNA-Pro
  16. Anolis carolinensis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 3)
  17. Apis dorsata tRNA-Pro
  18. Apis florea tRNA-Pro
  19. Apis mellifera tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4)
  20. Aplysia californica tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 12)
  21. Astyanax mexicanus tRNA
  22. Ataeniobius toweri tRNA-Pro
  23. Athalia rosae misc RNA ENSAEAG00005013499.1
  24. Atta cephalotes tRNA LOC105616937-2
  25. Atta colombica tRNA
  26. Balaenoptera acutorostrata scammoni tRNA-Pro (AGG) (tRNA-Pro-AGG-2 1 to 6)
  27. Biomphalaria glabrata tRNA tRNA-Pro
  28. Biomphalaria pfeifferi tRNA-Pro
  29. Blattella germanica tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 13)
  30. Bombus huntii (Hunt's bumblebee) transfer RNA proline (anticodon AGG)
  31. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119278
  32. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Pro
  33. Bos taurus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 13)
  34. Caligus rogercresseyi tRNA-Pro
  35. Callipepla squamata (scaled quail) tRNA
  36. Callithrix jacchus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  37. Callorhinchus milii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  38. Calypte anna (Anna's hummingbird) tRNA
  39. Camelus ferus tRNA
  40. Camponotus floridanus (Florida carpenter ant) tRNA-Pro
  41. Canis lupus familiaris tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  42. Antrostomus carolinensis tRNA
  43. Carlito syrichta tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  44. Cataglyphis hispanica (Desert ant) transfer RNA proline (anticodon AGG)
  45. Cavia porcellus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  46. Centruroides sculpturatus (Bark scorpion) tRNA-Pro
  47. Ceratotherium simum simum tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  48. Chaetura pelagica (chimney swift) tRNA
  49. Characodon lateralis tRNA-Pro
  50. Charadrius vociferus tRNA
  51. Chelonia mydas tRNA
  52. Chelonus insularis tRNA-Pro
  53. Chelydra serpentina tRNA-Pro
  54. Chlamydotis macqueenii tRNA
  55. Chlorocebus sabaeus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  56. Choloepus hoffmanni tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  57. Chrysemys picta bellii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  58. Ciona intestinalis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 3)
  59. Colinus virginianus (northern bobwhite) tRNA
  60. Colius striatus (speckled mousebird) tRNA
  61. Columba livia tRNA
  62. Copidosoma floridanum tRNA-Pro
  63. Cordylochernes scorpioides tRNA-Pro
  64. Corvus brachyrhynchos (American crow) tRNA
  65. Cotesia glomerata tRNA-Pro
  66. Crassostrea angulata (Portuguese oyster) transfer RNA proline (anticodon AGG)
  67. Crassostrea gigas (Pacific oyster) tRNA-Pro for anticodon AGG
  68. Crassostrea virginica (Eastern oyster) tRNA-Pro
  69. Crenichthys baileyi tRNA-Pro
  70. Cricetulus griseus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  71. Cryptotermes secundus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4)
  72. Cuculus canorus tRNA
  73. Cyphomyrmex costatus tRNA
  74. Dallia pectoralis tRNA-OTHER
  75. Danionella translucida tRNA-Pro
  76. Danio rerio tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 106)
  77. Daphnia magna (Fresh water planktonic) tRNA-Pro
  78. Daphnia pulex tRNA-Pro for anticodon AGG
  79. Dasypus novemcinctus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  80. Dermacentor andersoni transfer RNA proline (anticodon AGG)
  81. Dermacentor silvarum (Tick) transfer RNA proline (anticodon AGG)
  82. Dicentrarchus labrax (European seabass) transfer RNA-Pro
  83. Dipodomys ordii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  84. Dreissena polymorpha (Zebra mussle) transfer RNA proline (anticodon AGG)
  85. Dryococelus australis tRNA-OTHER
  86. Dufourea novaeangliae tRNA-Pro
  87. Echinops telfairi tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
  88. Egretta garzetta tRNA
  89. Eptesicus nilssonii tRNA-Pro
  90. Equus caballus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 10)
  91. Erinaceus europaeus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  92. Eschrichtius robustus tRNA-Pro
  93. Eufriesea mexicana tRNA-Pro
  94. Eurypyga helias (sunbittern) tRNA
  95. Felis catus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 14)
  96. Ficedula albicollis tRNA
  97. Frieseomelitta varia (marmelada) tRNA-Pro
  98. Fukomys damarensis tRNA
  99. Gadus morhua tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  100. Galendromus occidentalis (Western predatory mite) tRNA-Pro
  101. Gallus gallus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  102. Gasterosteus aculeatus tRNA
  103. Geospiza fortis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4)
  104. Gorilla gorilla gorilla tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  105. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Pro
  106. Haemaphysalis longicornis (Longhorned tick) tRNA-Pro for anticodon AGG
  107. Haliotis rubra tRNA-Pro
  108. Haliotis rufescens tRNA-Pro
  109. Harpegnathos saltator (Indian jumping ant) tRNA-Pro
  110. Helobdella robusta tRNA-Pro for anticodon AGG
  111. Heterocephalus glaber tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
  112. Hippoglossus stenolepis tRNA-Pro
  113. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Pro
  114. Homo sapiens tRNA-Pro (anticodon AGG) 2-1 (TRP-AGG2 1 to 8)
  115. Hyalella azteca tRNA-Pro
  116. Hyalomma asiaticum tRNA-Pro for anticodon AGG
  117. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005004623.1
  118. Ictidomys tridecemlineatus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  119. Ixodes persulcatus tRNA-Pro for anticodon AGG
  120. Ixodes scapularis tRNA-Pro for anticodon AGG
  121. Lamprotornis superbus tRNA-OTHER
  122. Larimichthys crocea tRNA
  123. Lasius niger tRNA
  124. Latimeria chalumnae tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 3)
  125. Lepisosteus oculatus (spotted gar) tRNA
  126. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Pro
  127. Linepithema humile tRNA-Pro
  128. Loxodonta africana tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 10)
  129. Macaca mulatta tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4, tRNA-Pro-AGG-1 6 to 9)
  130. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA proline (anticodon AGG)
  131. Manacus vitellinus tRNA
  132. Marmota monax (woodchuck) tRNA.Pro
  133. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Pro
  134. Megalops atlanticus tRNA-Pro
  135. Meleagris gallopavo tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  136. Melipona bicolor tRNA-Pro
  137. Melipona quadrifasciata tRNA
  138. Melopsittacus undulatus tRNA-Pro (AGG) (tRNA-Pro-AGG-1-1)
  139. Mercenaria mercenaria tRNA-Pro
  140. Merluccius polli tRNA-Pro
  141. Merops nubicus tRNA
  142. Mesitornis unicolor tRNA
  143. Mesocricetus auratus tRNA
  144. Microcebus murinus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  145. Monodelphis domestica tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 11)
  146. Monomorium pharaonis tRNA-Pro
  147. Mus caroli tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  148. Mus musculus castaneus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
  149. Mus musculus domesticus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  150. Mus musculus musculus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  151. Mus musculus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  152. Mus pahari tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  153. Mus spretus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  154. Mustela putorius furo tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  155. Mya arenaria (Soft-shell clam) transfer RNA proline (anticodon AGG)
  156. Myotis brandtii tRNA
  157. Myotis davidii tRNA
  158. Myotis lucifugus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  159. Neodiprion lecontei tRNA-Pro
  160. Neotoma lepida (desert woodrat) tRNA
  161. Nilaparvata lugens tRNA-Pro
  162. Nipponia nippon (crested ibis) tRNA
  163. Nomascus leucogenys tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  164. Notamacropus eugenii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
  165. Nothobranchius furzeri tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6)
  166. Ochotona princeps tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  167. Octopus sinensis (East Asian common octopus) tRNA-Pro
  168. Ooceraea biroi (Clonal raider ant) tRNA-Pro
  169. Ophiophagus hannah tRNA
  170. Opisthocomus hoazin tRNA
  171. Oppia nitens (Oribatid soil mite) transfer RNA proline (anticodon AGG)
  172. Oreochromis niloticus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 10)
  173. Ornithorhynchus anatinus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 13)
  174. Orussus abietinus (Parasitic wood wasp) tRNA-Pro
  175. Oryctolagus cuniculus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  176. Oryzias latipes tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 58)
  177. Ostrea edulis (European flat oyster) transfer RNA proline (anticodon AGG)
  178. Otolemur garnettii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  179. Ovis aries tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  180. Pangasianodon gigas tRNA-Pro
  181. Pangasianodon hypophthalmus tRNA-Pro
  182. Pangasius djambal tRNA-Pro
  183. Pan troglodytes tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  184. Papio anubis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6, tRNA-Pro-AGG-2-1)
  185. Patagioenas fasciata monilis tRNA
  186. Pediculus humanus corporis tRNA
  187. Pelobates cultripes tRNA.Pro
  188. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  189. Perca flavescens (yellow perch) tRNA-Pro
  190. Perca fluviatilis (European perch) tRNA-Pro
  191. Petromyzon marinus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 33)
  192. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  193. Dryobates pubescens tRNA
  194. Pleuronectes platessa tRNA-Pro
  195. Podarcis lilfordi tRNA.Pro
  196. Poecilia formosa tRNA
  197. Pogonomyrmex barbatus tRNA-Pro
  198. Polistes canadensis tRNA-Pro
  199. Polistes dominula (European paper wasp) tRNA-Pro
  200. Polistes fuscatus (Common paper wasp) tRNA-Pro
  201. Pollicipes pollicipes tRNA-Pro
  202. Pomacea canaliculata tRNA-Pro
  203. Pongo abelii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 6, tRNA-Pro-AGG-1-8)
  204. Potamilus streckersoni tRNA-Pro
  205. Priapulus caudatus tRNA-Pro
  206. Procavia capensis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  207. Prochlorococcaceae cyanobacterium ETNP7_MAG_30 tRNA-Pro
  208. Pseudomonadota bacterium tRNA-Pro
  209. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  210. Pteropus alecto (black flying fox) tRNA
  211. Rattus norvegicus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 7)
  212. Rhipicephalus microplus tRNA-Pro
  213. Rhipicephalus sanguineus (Brown dog tick) tRNA-Pro
  214. Rhodnius prolixus tRNA
  215. Saimiri boliviensis boliviensis tRNA-Pro (AGG) (tRNA-Pro-AGG-1-1, tRNA-Pro-AGG-1-2, tRNA-Pro-AGG-1 4 to 6)
  216. Salmo salar (Atlantic salmon) tRNA
  217. SAR324 cluster bacterium tRNA-Pro
  218. Sarcophilus harrisii tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  219. Schistocerca americana tRNA-Pro
  220. Schistocerca cancellata (South American locust) transfer RNA proline (anticodon AGG)
  221. Schistocerca gregaria (Grasshoppers) transfer RNA proline (anticodon AGG)
  222. Schistocerca nitens (Vagrant locust) transfer RNA proline (anticodon AGG)
  223. Schistocerca piceifrons (Central American locust) tRNA-Pro
  224. Schistocerca serialis cubense (Grasshoppers) transfer RNA proline (anticodon AGG)
  225. Scleropages formosus tRNA
  226. Solenopsis invicta (red fire ant) tRNA
  227. Sorex araneus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  228. Sphaerodactylus townsendi tRNA-Pro
  229. Struthio camelus australis tRNA
  230. Sus scrofa tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  231. Taeniopygia guttata tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 4)
  232. Takifugu rubripes tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  233. Tauraco erythrolophus tRNA
  234. Tetraodon nigroviridis tRNA
  235. Tinamus guttatus tRNA
  236. Trachymyrmex cornetzi tRNA
  237. Trachymyrmex septentrionalis tRNA
  238. Trachymyrmex zeteki tRNA
  239. Trichechus manatus latirostris tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 8)
  240. Trichomalopsis sarcophagae tRNA
  241. Tropilaelaps mercedesae tRNA
  242. Tupaia chinensis (Chinese tree shrew) tRNA
  243. Tursiops truncatus tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
  244. Varroa destructor (Honeybee mite) tRNA-Pro
  245. Varroa jacobsoni (Varroa mite) tRNA-Pro
  246. Venturia canescens (Endoparasitoid wasp) tRNA-Pro
  247. Vicugna pacos tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 9)
  248. Xenopus laevis tRNA
  249. Xenopus tropicalis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 46)
  250. Xiphophorus maculatus (southern platyfish) tRNA
  251. Zootermopsis nevadensis tRNA-Pro (AGG) (tRNA-Pro-AGG-1 1 to 5)
2D structure Publications