Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Locusta migratoria (migratory locust) lmi-miR-276-5p URS00005D9A90_7004

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCGAGGUAUAGAGUUCCUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-276b
  2. Bombyx mori bmo-miR-276-5p
  3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-276b-5p
  4. Cochliomyia macellaria mature cma-miR-276b-5p
  5. Drosophila ananassae Dan-Mir-276-P1_5p (mature (guide))
  6. Drosophila melanogaster (fruit fly) Dme-Mir-276-P1_5p (mature (co-guide))
  7. Drosophila mojavensis Dmo-Mir-276-P1_5p (mature (guide))
  8. Heliconius melpomene hme-miR-276
  9. Penaeus japonicus miR-276a*
  10. Triops cancriformis tcf-miR-276-5p