Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-690 URS00005D3E30_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-690: mmu-mir-690 is a microRNA that has been identified in various studies [PMC7399063]. It has been found to be upregulated during H7N9/AH1-PB2-627E replication in mice [PMC7399063]. Additionally, mmu-mir-690 has been shown to be downregulated at ST and IT, but not at LT [PMC3030602]. It is also a potential inhibitor of CTSE and CD3G production, suggesting that its downregulation could increase the activation of T cells [PMC3030602]. Furthermore, mmu-mir-690 has been predicted as a "Moderate Target" in the context of its interaction with RBBP5 [PMC9498445]. It has also been found to be enriched in mitochondria of the failing heart [PMC9736401]. The TarBase dataset revealed 157 putative targets for mmu-mir-690 [PMC5632880]. In another study, mmu-mir-690 was upregulated in exosomes compared to parent MIN6 cells [PMC7695333]. Additionally, mmu-mir-690 was one of the differentially expressed miRNAs that showed induction in TCE-treated mice and potential involvement in inflammatory responses [PMC9001960].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGGCUAGGCUCACAACCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications