Pongo pygmaeus (Bornean orangutan) ppy-miR-139-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-139-5p URS00005D2665_9600

22 nucleotides
1 database (miRBase)
Found in 9 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCUACAGUGCACGUGUCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Cricetulus griseus (Chinese hamster) cgr-miR-139-5p
Equus caballus (horse) eca-miR-139-5p
Gorilla gorilla gorilla ggo-miR-139 (MIR139)
Gorilla gorilla ggo-miR-139
Macaca mulatta mml-miR-139-5p
Mus musculus (house mouse) mmu-miR-139-5p
Pteropus alecto (black flying fox) pal-miR-139-5p
Rattus norvegicus rno-miR-139-5p
Sus scrofa (pig) ssc-miR-139-5p