Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00005C5DAF_559292

Automated summary: This snoRNA sequence is 462 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, IntAct, SGD, RefSeq). Described in 135 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Fungi_U3, RF01846). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR17B gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11622498 intact:EBI-10889363 EBI-10889363 rrna 20s
EBI-11622336 P25635 D6VR63 EBI-14332 P25633 P25635 P25636 PWP2 U three protein 1 U3 small nucleolar RNA-associated protein 1 UTP1 YCR057C YCR55C/YCR57C/YCR58C pwp2_yeast
EBI-11622328 Q12481 D6W2Y5 EBI-31770 Q12481 RRP36 Ribosomal RNA-processing protein 36 YOR287C rrp36_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCGACGUACUUCAGUAUGUUUUAUACCAUAUACUUUAUUAGGAAUAUAACAAAGCAUACCCAAUAAUUAGGCAAUGCGAUUGUCGUAUUCAACAACCAUCUUCUAUUUCACCAGCUUCAGGUUUUGACUAACACAUUCAACAGUAGGAUCAUUUCUAUAGGAAUCGUCACUCUUUGACUCUUCAAAAGAGCCACUGAAUCCAACUUGGUUGAUGAGCCCCAUAACCUUUGUACCCCAGAGUGAGGAAAUGAAAUCGAAUUUAAAUUAGCUUGGUCCGCAAUCCUUAGCGGUUCGGCCAUCUAUAAUUUUGAAUAAAAUUUUGCUUUGCCGUUGCAAUUGUGAUAACUUCCUUUGGAAUUUGUUGCGAUAUUUAAUGGCGCGAUGAUCUUGACCCAUCCUAUGUGCUUCCAUUUUGGAAGGAUAGGGAUUCAUGGGUGGGUACAAAUGGCAGUCUGACAAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Saccharomyces cerevisiae SNR17B
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR17b
    3. Saccharomyces cerevisiae YJM1083 SNR17B
    4. Saccharomyces cerevisiae YJM1199 SNR17B
    5. Saccharomyces cerevisiae YJM1202 SNR17B
    6. Saccharomyces cerevisiae YJM1248 SNR17B
    7. Saccharomyces cerevisiae YJM1273 SNR17B
    8. Saccharomyces cerevisiae YJM1307 SNR17B
    9. Saccharomyces cerevisiae YJM1338 SNR17B
    10. Saccharomyces cerevisiae YJM1387 SNR17B
    11. Saccharomyces cerevisiae YJM1388 SNR17B
    12. Saccharomyces cerevisiae YJM1389 SNR17B
    13. Saccharomyces cerevisiae YJM1399 SNR17B
    14. Saccharomyces cerevisiae YJM1400 SNR17B
    15. Saccharomyces cerevisiae YJM1402 SNR17B
    16. Saccharomyces cerevisiae YJM1419 SNR17B
    17. Saccharomyces cerevisiae YJM1433 SNR17B
    18. Saccharomyces cerevisiae YJM1434 SNR17B
    19. Saccharomyces cerevisiae YJM1439 SNR17B
    20. Saccharomyces cerevisiae YJM1443 SNR17B
    21. Saccharomyces cerevisiae YJM1444 SNR17B
    22. Saccharomyces cerevisiae YJM1447 SNR17B
    23. Saccharomyces cerevisiae YJM1450 SNR17B
    24. Saccharomyces cerevisiae YJM1460 SNR17B
    25. Saccharomyces cerevisiae YJM1479 SNR17B
    26. Saccharomyces cerevisiae YJM1527 SNR17B
    27. Saccharomyces cerevisiae YJM1549 SNR17B
    28. Saccharomyces cerevisiae YJM1573 SNR17B
    29. Saccharomyces cerevisiae YJM1592 SNR17B
    30. Saccharomyces cerevisiae YJM1615 SNR17B
    31. Saccharomyces cerevisiae YJM193 SNR17B
    32. Saccharomyces cerevisiae YJM195 SNR17B
    33. Saccharomyces cerevisiae YJM271 SNR17B
    34. Saccharomyces cerevisiae YJM428 SNR17B
    35. Saccharomyces cerevisiae YJM456 SNR17B
    36. Saccharomyces cerevisiae YJM555 SNR17B
    37. Saccharomyces cerevisiae YJM689 SNR17B
    38. Saccharomyces cerevisiae YJM693 SNR17B
    2D structure New