Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG) secondary structure diagram

Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG) URS00005BE569_7011

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAAUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Drosophila melanogaster transfer RNA:Arginine-TCG 1-1 (Dmel_CR32610)
  2. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  3. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  4. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1)
  5. Oryctes borbonicus tRNA
  6. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  7. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  8. Schistocerca americana (American grasshopper) tRNA-Arg
  9. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  10. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  11. Schistocerca piceifrons (Central American locust) tRNA-Arg
  12. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  13. Steinernema glaseri tRNA
2D structure