Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Salmonella enterica subsp. enterica serovar Tanger tRNA-Phe secondary structure diagram

Salmonella enterica subsp. enterica serovar Tanger tRNA-Phe URS00005AA258_2565083

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10,911 other species

  1. Acerihabitans sp. KWT1480 tRNA-Phe
  2. Acerihabitans sp. TG2 tRNA-Phe
  3. Acerihabitans sp. tRNA-Phe
  4. Escherichia coli tRNA-Phe(gaa)
  5. Acinetobacter baumannii tRNA-Phe(gaa)
  6. Algoriphagus aestuariicola tRNA-Phe
  7. Alistipes onderdonkii tRNA-Phe
  8. Thermus thermophilus HB8 A-site tRNA from Thermus thermophilus HB8 (PDB 5J8B, chain w)
  9. Atlantibacter hermannii tRNA-Phe(gaa)
  10. Atlantibacter sp. MEI4A-1023 tRNA-Phe
  11. Atlantibacter sp. RC6 tRNA-Phe
  12. Atlantibacter sp. SORGH_AS_0304 tRNA-Phe
  13. Atlantibacter subterraneus tRNA-Phe
  14. Bacillus amyloliquefaciens tRNA-Phe
  15. Bacillus cereus tRNA-Phe
  16. Bacillus sp. SRB_28 tRNA-Phe
  17. bacterium 19GA11TI05 tRNA-Phe
  18. bacterium BS0013 tRNA-Phe
  19. bacterium RGF134-1 tRNA-Phe
  20. Bacteroides thetaiotaomicron tRNA-Phe
  21. Symbiopectobacterium tRNA-Phe
  22. Bruguierivorax albus tRNA-Phe
  23. Budvicia aquatica tRNA-Phe
  24. Budvicia sp. (wastewater metagenome) tRNA-Phe
  25. Buttiauxella agrestis ATCC 33320 tRNA-Phe
  26. Buttiauxella agrestis tRNA-Phe
  27. Buttiauxella brennerae ATCC 51605 tRNA-Phe
  28. Buttiauxella ferragutiae ATCC 51602 tRNA-Phe
  29. Buttiauxella ferragutiae tRNA-Phe
  30. Buttiauxella gaviniae ATCC 51604 tRNA-Phe
  31. Buttiauxella gaviniae tRNA-Phe
  32. Buttiauxella izardii tRNA-Phe
  33. Buttiauxella noackiae ATCC 51607 tRNA-Phe
  34. Buttiauxella noackiae tRNA-Phe
  35. Buttiauxella sp. 3AFRM03 tRNA-Phe
  36. Buttiauxella sp. A111 tRNA-Phe
  37. Buttiauxella sp. A2-C1_F tRNA-Phe
  38. Buttiauxella sp. B2 tRNA-Phe
  39. Buttiauxella sp. BIGb0471 tRNA-Phe
  40. Buttiauxella sp. HR94 tRNA-Phe
  41. Buttiauxella selenatireducens tRNA-Phe
  42. Buttiauxella sp. S04-F03 tRNA-Phe
  43. Buttiauxella sp. tRNA-Phe
  44. Buttiauxella sp. W03-F01 tRNA-Phe
  45. Buttiauxella sp. WJP83 tRNA-Phe
  46. Buttiauxella warmboldiae tRNA-Phe
  47. Candidatus Kosakonia sp. 282A-S69 tRNA-Phe
  48. Candidatus Malihini olakiniferum tRNA-Phe
  49. Candidatus Schmidhempelia bombi str. Bimp tRNA-Phe
  50. Candidatus Sodalis endolongispinus tRNA-Phe
  51. Candidatus Sodalis pierantonii str. SOPE tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  52. Candidatus Symbiopectobacterium endolongispinus tRNA-Phe
  53. Candidatus Symbiopectobacterium sp. Chty_BC tRNA-Phe
  54. Candidatus Symbiopectobacterium sp. NZEC127 tRNA-Phe
  55. Candidatus Symbiopectobacterium sp. NZEC135 tRNA-Phe
  56. Candidatus Symbiopectobacterium sp. NZEC151 tRNA-Phe
  57. Candidatus Symbiopectobacterium sp. PLON1 tRNA-Phe
  58. Symbiopectobacterium purcellii tRNA-Phe
  59. Cedecea colo tRNA-Phe
  60. Cedecea davisae DSM 4568 tRNA-Phe
  61. Cedecea davisae tRNA-Phe(gaa)
  62. Cedecea lapagei tRNA-Phe
  63. Cedecea neteri tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  64. Cedecea selenatireducens tRNA-Phe
  65. Cedecea sp. FDAARGOS_727 tRNA-Phe
  66. Cedecea sp. P7760 tRNA-Phe
  67. Cedecea sp. tRNA-Phe
  68. Chania multitudinisentens RB-25 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  69. Chania sp. tRNA-Phe
  70. Chimaeribacter sp. YP20170169 tRNA-Phe
  71. Citrobacter amalonaticus tRNA-Phe(gaa)
  72. Citrobacter amalonaticus Y19 tRNA-Phe
  73. Citrobacter bitternis tRNA-Phe
  74. Citrobacter braakii tRNA-Phe(gaa)
  75. Citrobacter cronae tRNA-Phe(gaa)
  76. Citrobacter europaeus tRNA-Phe
  77. Citrobacter farmeri GTC 1319 tRNA-Phe
  78. Citrobacter farmeri tRNA-Phe
  79. Citrobacter freundii 4_7_47CFAA tRNA-Phe
  80. Citrobacter freundii 47N tRNA-Phe
  81. Citrobacter freundii 5-172-05_S1_C1 tRNA-Phe
  82. Citrobacter freundii ATCC 8090 = MTCC 1658 = NBRC 12681 = NBRC 12681 tRNA-Phe
  83. Citrobacter freundii CFNIH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  84. Citrobacter freundii complex sp. 2022EL-00793 tRNA-Phe
  85. Citrobacter freundii complex sp. 2022EL-00822 tRNA-Phe
  86. Citrobacter freundii complex sp. 2022EL-00971 tRNA-Phe
  87. Citrobacter freundii complex sp. 2022EL-00972 tRNA-Phe
  88. Citrobacter freundii complex sp. 2023EL-00961 tRNA-Phe
  89. Citrobacter freundii complex sp. 2023EL-00962 tRNA-Phe
  90. Citrobacter freundii complex sp. 2023EL-00966 tRNA-Phe
  91. Citrobacter freundii complex sp. 2024EL-00216 tRNA-Phe
  92. Citrobacter freundii complex sp. 2024EL-00217 tRNA-Phe
  93. Citrobacter freundii complex sp. 2024EL-00219 tRNA-Phe
  94. Citrobacter freundii complex sp. 2024EL-00220 tRNA-Phe
  95. Citrobacter freundii complex sp. 2024EL-00223 tRNA-Phe
  96. Citrobacter freundii complex sp. 2024EL-00224 tRNA-Phe
  97. Citrobacter freundii complex sp. 2024EL-00225 tRNA-Phe
  98. Citrobacter freundii complex sp. 2024EL-00228 tRNA-Phe
  99. Citrobacter freundii complex sp. 2024EL-00230 tRNA-Phe
  100. Citrobacter freundii complex sp. 2024EL-00235 tRNA-Phe
  101. Citrobacter freundii complex sp. 2024EL-00236 tRNA-Phe
  102. Citrobacter freundii complex sp. 2024EL-00237 tRNA-Phe
  103. Citrobacter freundii complex sp. 2024EL-00238 tRNA-Phe
  104. Citrobacter freundii complex sp. 2024EL-00241 tRNA-Phe
  105. Citrobacter freundii complex sp. 2024EL-00614 tRNA-Phe
  106. Citrobacter freundii complex sp. 2024EL-00748 tRNA-Phe
  107. Citrobacter freundii complex sp. 2025EL-00176 tRNA-Phe
  108. Citrobacter freundii complex sp. 2025EL-00205 tRNA-Phe
  109. Citrobacter freundii complex sp. CFNIH11 tRNA-Phe
  110. Citrobacter freundii complex sp. CFNIH12 tRNA-Phe
  111. Citrobacter freundii complex sp. CFNIH2 tRNA-Phe
  112. Citrobacter freundii complex sp. CFNIH3 tRNA-Phe
  113. Citrobacter freundii complex sp. CFNIH4 tRNA-Phe
  114. Citrobacter freundii complex sp. CFNIH5 tRNA-Phe
  115. Citrobacter freundii complex sp. CFNIH6 tRNA-Phe
  116. Citrobacter freundii complex sp. CFNIH7 tRNA-Phe
  117. Citrobacter freundii complex sp. CFNIH8 tRNA-Phe
  118. Citrobacter freundii complex sp. CFNIH9 tRNA-Phe
  119. Citrobacter freundii GTC 09479 tRNA-Phe
  120. Citrobacter freundii GTC 09629 tRNA-Phe
  121. Citrobacter freundii MGH 56 tRNA-Phe
  122. Citrobacter freundii tRNA-Phe
  123. Citrobacter freundii RLS1 tRNA-Phe
  124. Citrobacter freundii UCI 31 tRNA-Phe
  125. Citrobacter freundii UCI 32 tRNA-Phe
  126. Citrobacter gillenii tRNA-Phe
  127. Citrobacter koseri ATCC BAA-895 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  128. Citrobacter koseri tRNA-Phe(gaa)
  129. Citrobacter meridianamericanus tRNA-Phe
  130. Citrobacter murliniae tRNA-Phe
  131. Citrobacter pasteurii (gut metagenome) tRNA-Phe
  132. Citrobacter portucalensis tRNA-Phe(gaa)
  133. Citrobacter rodentium ICC168 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  134. Citrobacter rodentium NBRC 105723 = DSM 16636 tRNA-Phe
  135. Citrobacter rodentium tRNA-Phe
  136. Citrobacter sedlakii tRNA-Phe(gaa)
  137. Citrobacter sp. 172116965 tRNA-Phe
  138. Citrobacter sp. 210820-DFI.7.7 tRNA-Phe
  139. Citrobacter sp. 210820-DFI.7.8 tRNA-Phe
  140. Citrobacter sp. 21OH12SH02A-Citro tRNA-Phe
  141. Citrobacter sp. 50677481 tRNA-Phe
  142. Citrobacter sp. 506 tRNA-Phe
  143. Citrobacter sp. 70972423 tRNA-Phe
  144. Citrobacter sp. A1 tRNA-Phe
  145. Citrobacter sp. A316 tRNA-Phe
  146. Citrobacter sp. AAK_AS5 tRNA-Phe
  147. Citrobacter sp. AATXQ tRNA-Phe
  148. Citrobacter sp. AATXR tRNA-Phe
  149. Citrobacter sp. ABFQG tRNA-Phe
  150. Citrobacter sp. ANG330 tRNA-Phe
  151. Citrobacter sp. AN-PRR1 tRNA-Phe
  152. Citrobacter sp. Awk 2 tRNA-Phe
  153. Citrobacter sp. Awk 4 tRNA-Phe
  154. Citrobacter sp. B72 tRNA-Phe
  155. Citrobacter sp. BDA59-3 tRNA-Phe
  156. Citrobacter sp. BIDMC107 tRNA-Phe
  157. Citrobacter sp. BIDMC108 tRNA-Phe
  158. Citrobacter sp. BNK-39 tRNA-Phe
  159. Citrobacter sp. BNK-40 tRNA-Phe
  160. Citrobacter sp. BNK-41 tRNA-Phe
  161. Citrobacter sp. BNK-42 tRNA-Phe
  162. Citrobacter sp. C13 tRNA-Phe
  163. Citrobacter sp. C1 tRNA-Phe
  164. Citrobacter sp. C348 tRNA-Phe
  165. Citrobacter sp. C411 tRNA-Phe
  166. Citrobacter sp. C5_2 tRNA-Phe
  167. Citrobacter sp. C6_1 tRNA-Phe
  168. Citrobacter sp. C6_2 tRNA-Phe
  169. Citrobacter sp. Ca225 tRNA-Phe
  170. Citrobacter sp. Ca226 tRNA-Phe
  171. Citrobacter sp. Cb002 tRNA-Phe
  172. Citrobacter sp. Cb003 tRNA-Phe
  173. Citrobacter sp. Cb004 tRNA-Phe
  174. Citrobacter sp. Cb005 tRNA-Phe
  175. Citrobacter sp. Cb007 tRNA-Phe
  176. Citrobacter sp. Cb008 tRNA-Phe
  177. Citrobacter sp. Cb009 tRNA-Phe
  178. Citrobacter sp. Cb010 tRNA-Phe
  179. Citrobacter sp. Cb011 tRNA-Phe
  180. Citrobacter sp. Cb013 tRNA-Phe
  181. Citrobacter sp. Cb014 tRNA-Phe
  182. Citrobacter sp. Cb016 tRNA-Phe
  183. Citrobacter sp. Cb018 tRNA-Phe
  184. Citrobacter sp. Cb019 tRNA-Phe
  185. Citrobacter sp. Cb021 tRNA-Phe
  186. Citrobacter sp. Cb022 tRNA-Phe
  187. Citrobacter sp. Cb023 tRNA-Phe
  188. Citrobacter sp. Cb025 tRNA-Phe
  189. Citrobacter sp. Cb026 tRNA-Phe
  190. Citrobacter sp. Cb027 tRNA-Phe
  191. Citrobacter sp. Cb028 tRNA-Phe
  192. Citrobacter sp. Cb031 tRNA-Phe
  193. Citrobacter sp. Cb034 tRNA-Phe
  194. Citrobacter sp. Cb036 tRNA-Phe
  195. Citrobacter sp. Cb041 tRNA-Phe
  196. Citrobacter sp. Cb043 tRNA-Phe
  197. Citrobacter sp. Cb063 tRNA-Phe
  198. Citrobacter sp. Cb080 tRNA-Phe
  199. Citrobacter sp. Cb127 tRNA-Phe
  200. Citrobacter sp. Cb130 tRNA-Phe
  201. Citrobacter sp. Cb220 tRNA-Phe
  202. Citrobacter sp. Cb223 tRNA-Phe
  203. Citrobacter sp. Cc067 tRNA-Phe
  204. Citrobacter sp. Cc139 tRNA-Phe
  205. Citrobacter sp. Cc227 tRNA-Phe
  206. Citrobacter sp. Ce006 tRNA-Phe
  207. Citrobacter sp. Ce104 tRNA-Phe
  208. Citrobacter sp. Ce105 tRNA-Phe
  209. Citrobacter sp. Ce119 tRNA-Phe
  210. Citrobacter sp. Ce129 tRNA-Phe
  211. Citrobacter sp. Cf039 tRNA-Phe
  212. Citrobacter sp. Cf042 tRNA-Phe
  213. Citrobacter sp. Cf062 tRNA-Phe
  214. Citrobacter sp. Cf068 tRNA-Phe
  215. Citrobacter sp. Cf072 tRNA-Phe
  216. Citrobacter sp. Cf077 tRNA-Phe
  217. Citrobacter sp. Cf078 tRNA-Phe
  218. Citrobacter sp. Cf079 tRNA-Phe
  219. Citrobacter sp. Cf081 tRNA-Phe
  220. Citrobacter sp. Cf084 tRNA-Phe
  221. Citrobacter sp. Cf087 tRNA-Phe
  222. Citrobacter sp. Cf088 tRNA-Phe
  223. Citrobacter sp. Cf093 tRNA-Phe
  224. Citrobacter sp. Cf094 tRNA-Phe
  225. Citrobacter sp. Cf095 tRNA-Phe
  226. Citrobacter sp. Cf097 tRNA-Phe
  227. Citrobacter sp. Cf098 tRNA-Phe
  228. Citrobacter sp. Cf099 tRNA-Phe
  229. Citrobacter sp. Cf101 tRNA-Phe
  230. Citrobacter sp. Cf108 tRNA-Phe
  231. Citrobacter sp. Cf111 tRNA-Phe
  232. Citrobacter sp. Cf112 tRNA-Phe
  233. Citrobacter sp. Cf115 tRNA-Phe
  234. Citrobacter sp. Cf116 tRNA-Phe
  235. Citrobacter sp. Cf117 tRNA-Phe
  236. Citrobacter sp. Cf118 tRNA-Phe
  237. Citrobacter sp. Cf120 tRNA-Phe
  238. Citrobacter sp. Cf121 tRNA-Phe
  239. Citrobacter sp. Cf122 tRNA-Phe
  240. Citrobacter sp. Cf123 tRNA-Phe
  241. Citrobacter sp. Cf124 tRNA-Phe
  242. Citrobacter sp. Cf125 tRNA-Phe
  243. Citrobacter sp. Cf128 tRNA-Phe
  244. Citrobacter sp. Cf132 tRNA-Phe
  245. Citrobacter sp. Cf133 tRNA-Phe
  246. Citrobacter sp. Cf134 tRNA-Phe
  247. Citrobacter sp. Cf135 tRNA-Phe
  248. Citrobacter sp. Cf136 tRNA-Phe
  249. Citrobacter sp. Cf138 tRNA-Phe
  250. Citrobacter sp. Cf140 tRNA-Phe
  251. Citrobacter sp. Cf141 tRNA-Phe
  252. Citrobacter sp. Cf145 tRNA-Phe
  253. Citrobacter sp. Cf146 tRNA-Phe
  254. Citrobacter sp. Cf224 tRNA-Phe
  255. Citrobacter sp. Cf236 tRNA-Phe
  256. Citrobacter sp. CF971 tRNA-Phe
  257. Citrobacter sp. CFNIH10 tRNA-Phe
  258. Citrobacter sp. CK180 tRNA-Phe
  259. Citrobacter sp. CK181 tRNA-Phe
  260. Citrobacter sp. CK182 tRNA-Phe
  261. Citrobacter sp. CK183 tRNA-Phe
  262. Citrobacter sp. CK184 tRNA-Phe
  263. Citrobacter sp. CK185 tRNA-Phe
  264. Citrobacter sp. CK186 tRNA-Phe
  265. Citrobacter sp. CK187 tRNA-Phe
  266. Citrobacter sp. CK188 tRNA-Phe
  267. Citrobacter sp. CK189 tRNA-Phe
  268. Citrobacter sp. CK190 tRNA-Phe
  269. Citrobacter sp. CK191 tRNA-Phe
  270. Citrobacter sp. CK192 tRNA-Phe
  271. Citrobacter sp. CK193 tRNA-Phe
  272. Citrobacter sp. CK194 tRNA-Phe
  273. Citrobacter sp. CK195 tRNA-Phe
  274. Citrobacter sp. CK196 tRNA-Phe
  275. Citrobacter sp. CK197 tRNA-Phe
  276. Citrobacter sp. CK198 tRNA-Phe
  277. Citrobacter sp. CK199 tRNA-Phe
  278. Citrobacter sp. CK200 tRNA-Phe
  279. Citrobacter sp. CK201 tRNA-Phe
  280. Citrobacter sp. CK202 tRNA-Phe
  281. Citrobacter sp. CK203 tRNA-Phe
  282. Citrobacter sp. CK204 tRNA-Phe
  283. Citrobacter sp. CK205 tRNA-Phe
  284. Citrobacter sp. CK206 tRNA-Phe
  285. Citrobacter sp. CK207 tRNA-Phe
  286. Citrobacter sp. Cm038 tRNA-Phe
  287. Citrobacter sp. Cm046 tRNA-Phe
  288. Citrobacter sp. Cpa228 tRNA-Phe
  289. Citrobacter sp. Cpo012 tRNA-Phe
  290. Citrobacter sp. Cpo015 tRNA-Phe
  291. Citrobacter sp. Cpo030 tRNA-Phe
  292. Citrobacter sp. Cpo032 tRNA-Phe
  293. Citrobacter sp. Cpo035 tRNA-Phe
  294. Citrobacter sp. Cpo037 tRNA-Phe
  295. Citrobacter sp. Cpo040 tRNA-Phe
  296. Citrobacter sp. Cpo044 tRNA-Phe
  297. Citrobacter sp. Cpo045 tRNA-Phe
  298. Citrobacter sp. Cpo060 tRNA-Phe
  299. Citrobacter sp. Cpo061 tRNA-Phe
  300. Citrobacter sp. Cpo065 tRNA-Phe
  301. Citrobacter sp. Cpo069 tRNA-Phe
  302. Citrobacter sp. Cpo071 tRNA-Phe
  303. Citrobacter sp. Cpo073 tRNA-Phe
  304. Citrobacter sp. Cpo074 tRNA-Phe
  305. Citrobacter sp. Cpo085 tRNA-Phe
  306. Citrobacter sp. Cpo086 tRNA-Phe
  307. Citrobacter sp. Cpo089 tRNA-Phe
  308. Citrobacter sp. Cpo090 tRNA-Phe
  309. Citrobacter sp. Cpo091 tRNA-Phe
  310. Citrobacter sp. Cpo100 tRNA-Phe
  311. Citrobacter sp. Cpo102 tRNA-Phe
  312. Citrobacter sp. Cpo103 tRNA-Phe
  313. Citrobacter sp. Cpo107 tRNA-Phe
  314. Citrobacter sp. Cpo109 tRNA-Phe
  315. Citrobacter sp. Cpo113 tRNA-Phe
  316. Citrobacter sp. Cpo114 tRNA-Phe
  317. Citrobacter sp. Cpo126 tRNA-Phe
  318. Citrobacter sp. Cpo131 tRNA-Phe
  319. Citrobacter sp. Cpo137 tRNA-Phe
  320. Citrobacter sp. Cpo142 tRNA-Phe
  321. Citrobacter sp. Cpo147 tRNA-Phe
  322. Citrobacter sp. Cpo148 tRNA-Phe
  323. Citrobacter sp. Cpo150 tRNA-Phe
  324. Citrobacter sp. Cpo221 tRNA-Phe
  325. Citrobacter sp. CRE-46 tRNA-Phe
  326. Citrobacter sp. Cs237 tRNA-Phe
  327. Citrobacter sp. Ct235 tRNA-Phe
  328. Citrobacter sp. Cu096 tRNA-Phe
  329. Citrobacter sp. Cu231 tRNA-Phe
  330. Citrobacter sp. Cu233 tRNA-Phe
  331. Citrobacter sp. Cy070 tRNA-Phe
  332. Citrobacter sp. Cy082 tRNA-Phe
  333. Citrobacter sp. Cy230 tRNA-Phe
  334. Citrobacter sp. Cy232 tRNA-Phe
  335. Citrobacter sp. Cy234 tRNA-Phe
  336. Citrobacter sp. DNRA3 tRNA-Phe
  337. Citrobacter sp. EBS8 tRNA-Phe
  338. Citrobacter sp. EC_71 tRNA-Phe
  339. Citrobacter sp. FDAARGOS_156 tRNA-Phe
  340. Citrobacter sp. HN-120 tRNA-Phe
  341. Citrobacter sp. HN-141 tRNA-Phe
  342. Citrobacter sp. HN-144 tRNA-Phe
  343. Citrobacter sp. HP152 tRNA-Phe
  344. Citrobacter sp. HP192 tRNA-Phe
  345. Citrobacter sp. HSTU-ABk15 tRNA-Phe
  346. Citrobacter sp. HSTU-bmb20 tRNA-Phe
  347. Citrobacter sp. Igbk 14 tRNA-Phe
  348. Citrobacter sp. Igbk 16 tRNA-Phe
  349. Citrobacter sp. Igbk 17 tRNA-Phe
  350. Citrobacter sp. JGM124 tRNA-Phe
  351. Citrobacter sp. JL976 tRNA-Phe
  352. Citrobacter sp. JL978 tRNA-Phe
  353. Citrobacter sp. JUb117 tRNA-Phe
  354. Citrobacter sp. KH_055_1 tRNA-Phe
  355. Citrobacter sp. KTE151 tRNA-Phe
  356. Citrobacter sp. KTE30 tRNA-Phe
  357. Citrobacter sp. KTE32 tRNA-Phe
  358. Citrobacter sp. ku-bf4 tRNA-Phe
  359. Citrobacter sp. L17 tRNA-Phe
  360. Citrobacter sp. L55 tRNA-Phe
  361. Citrobacter sp. LJND-P06 tRNA-Phe
  362. Citrobacter sp. LST-B2 tRNA-Phe
  363. Citrobacter sp. LUTT5 tRNA-Phe
  364. Citrobacter arsenatis tRNA-Phe
  365. Citrobacter sp. MAL-2 tRNA-Phe
  366. Citrobacter sp. MGH100 tRNA-Phe
  367. Citrobacter sp. MGH103 tRNA-Phe
  368. Citrobacter sp. MGH104 tRNA-Phe
  369. Citrobacter sp. MGH105 tRNA-Phe
  370. Citrobacter sp. MGH106 tRNA-Phe
  371. Citrobacter sp. MGH109 tRNA-Phe
  372. Citrobacter sp. MGH110 tRNA-Phe
  373. Citrobacter sp. MGH 55 tRNA-Phe
  374. Citrobacter sp. MGH99 tRNA-Phe
  375. Citrobacter sp. MH181794 tRNA-Phe
  376. Citrobacter sp. MNAZ 1397 tRNA-Phe
  377. Citrobacter sp. NCU1 tRNA-Phe
  378. Citrobacter telavivensis (Citrobacter sp. 6106) tRNA-Phe
  379. Citrobacter sp. On28M tRNA-Phe
  380. Citrobacter sp. On2M tRNA-Phe
  381. Citrobacter sp. OP27 tRNA-Phe
  382. Citrobacter sp. R-1.5.2 tRNA-Phe
  383. Citrobacter sp. R56 tRNA-Phe
  384. Citrobacter sp. RHB20-C15 tRNA-Phe
  385. Citrobacter sp. RHB20-C16 tRNA-Phe
  386. Citrobacter sp. RHB21-C01 tRNA-Phe
  387. Citrobacter sp. RHB21-C05 tRNA-Phe
  388. Citrobacter sp. RHB25-C09 tRNA-Phe
  389. Citrobacter sp. RHB35-C17 tRNA-Phe
  390. Citrobacter sp. RHB35-C21 tRNA-Phe
  391. Citrobacter sp. RHB36-C18 tRNA-Phe
  392. Citrobacter sp. RHBSTW-00013 tRNA-Phe
  393. Citrobacter sp. RHBSTW-00017 tRNA-Phe
  394. Citrobacter sp. RHBSTW-00021 tRNA-Phe
  395. Citrobacter sp. RHBSTW-00029 tRNA-Phe
  396. Citrobacter sp. RHBSTW-00053 tRNA-Phe
  397. Citrobacter sp. RHBSTW-00089 tRNA-Phe
  398. Citrobacter sp. RHBSTW-00104 tRNA-Phe
  399. Citrobacter sp. RHBSTW-00107 tRNA-Phe
  400. Citrobacter sp. RHBSTW-00127 tRNA-Phe
  401. Citrobacter sp. RHBSTW-00137 tRNA-Phe
  402. Citrobacter sp. RHBSTW-00229 tRNA-Phe
  403. Citrobacter sp. RHBSTW-00271 tRNA-Phe
  404. Citrobacter sp. RHBSTW-00325 tRNA-Phe
  405. Citrobacter sp. RHBSTW-00424 tRNA-Phe
  406. Citrobacter sp. RHBSTW-00446 tRNA-Phe
  407. Citrobacter sp. RHBSTW-00509 tRNA-Phe
  408. Citrobacter sp. RHBSTW-00524 tRNA-Phe
  409. Citrobacter sp. RHBSTW-00570 tRNA-Phe
  410. Citrobacter sp. RHBSTW-00599 tRNA-Phe
  411. Citrobacter sp. RHBSTW-00628 tRNA-Phe
  412. Citrobacter sp. RHBSTW-00667 tRNA-Phe
  413. Citrobacter sp. RHBSTW-00671 tRNA-Phe
  414. Citrobacter sp. RHBSTW-00678 tRNA-Phe
  415. Citrobacter sp. RHBSTW-00696 tRNA-Phe
  416. Citrobacter sp. RHBSTW-00821 tRNA-Phe
  417. Citrobacter sp. RHBSTW-00827 tRNA-Phe
  418. Citrobacter sp. RHBSTW-00848 tRNA-Phe
  419. Citrobacter sp. RHBSTW-00859 tRNA-Phe
  420. Citrobacter sp. RHBSTW-00881 tRNA-Phe
  421. Citrobacter sp. RHBSTW-00887 tRNA-Phe
  422. Citrobacter sp. RHBSTW-00903 tRNA-Phe
  423. Citrobacter sp. RHBSTW-00944 tRNA-Phe
  424. Citrobacter sp. RHBSTW-00976 tRNA-Phe
  425. Citrobacter sp. RHBSTW-00986 tRNA-Phe
  426. Citrobacter sp. RHBSTW-01013 tRNA-Phe
  427. Citrobacter sp. RHBSTW-01044 tRNA-Phe
  428. Citrobacter sp. RHBSTW-01065 tRNA-Phe
  429. Citrobacter enshiensis tRNA-Phe
  430. Citrobacter enshiensis tRNA-Phe
  431. Citrobacter sp. S39 tRNA-Phe
  432. Citrobacter sp. S44_ASV_140 tRNA-Phe
  433. Citrobacter sp. S46_ASV_140 tRNA-Phe
  434. Citrobacter sp. S55_ASV_140 tRNA-Phe
  435. Citrobacter sp. S5 tRNA-Phe
  436. Citrobacter sp. SL156 tRNA-Phe
  437. Citrobacter sp. SRB tRNA-Phe
  438. Citrobacter sp. SX206 tRNA-Phe
  439. Citrobacter sp. SX212 tRNA-Phe
  440. Citrobacter sp. T1.2D-1 tRNA-Phe(gaa)
  441. Citrobacter sp. TBCP-5362 tRNA-Phe
  442. Citrobacter sp. TBCS-11 tRNA-Phe
  443. Citrobacter sp. TBCS-14 tRNA-Phe
  444. Citrobacter sp. TBCS-15 tRNA-Phe
  445. Citrobacter sp. tRNA-Phe
  446. Citrobacter sp. TSA-1 tRNA-Phe
  447. Citrobacter sp. UYEF32 tRNA-Phe
  448. Citrobacter sp. VF227 tRNA-Phe
  449. Citrobacter sp. wls613 tRNA-Phe
  450. Citrobacter sp. wls615 tRNA-Phe
  451. Citrobacter sp. wls617 tRNA-Phe
  452. Citrobacter sp. wls618 tRNA-Phe
  453. Citrobacter sp. wls621 tRNA-Phe
  454. Citrobacter sp. wls706 tRNA-Phe
  455. Citrobacter sp. wls708 tRNA-Phe
  456. Citrobacter sp. wls710 tRNA-Phe
  457. Citrobacter sp. wls711 tRNA-Phe
  458. Citrobacter sp. wls712 tRNA-Phe
  459. Citrobacter sp. wls713 tRNA-Phe
  460. Citrobacter sp. wls714 tRNA-Phe
  461. Citrobacter sp. wls715 tRNA-Phe
  462. Citrobacter sp. wls716 tRNA-Phe
  463. Citrobacter sp. wls717 tRNA-Phe
  464. Citrobacter sp. wls718 tRNA-Phe
  465. Citrobacter sp. wls757 tRNA-Phe
  466. Citrobacter sp. wls758 tRNA-Phe
  467. Citrobacter sp. wls827 tRNA-Phe
  468. Citrobacter sp. wls828 tRNA-Phe
  469. Citrobacter sp. wls829 tRNA-Phe
  470. Citrobacter sp. wls830 tRNA-Phe
  471. Citrobacter sp. XT1-2-2 tRNA-Phe
  472. Citrobacter sp. XY323 tRNA-Phe
  473. Citrobacter sp. Y3 tRNA-Phe
  474. Citrobacter sp. zjy_2 tRNA-Phe
  475. Citrobacter telavivensis tRNA-Phe
  476. Citrobacter tructae tRNA-Phe
  477. Citrobacter werkmanii NBRC 105721 tRNA-Phe
  478. Citrobacter werkmanii tRNA-Phe(gaa)
  479. Citrobacter youngae ATCC 29220 tRNA-Phe
  480. Citrobacter youngae tRNA-Phe
  481. Clostridium butyricum tRNA-Phe
  482. Clostridium perfringens tRNA-Phe
  483. Clostridium sp. tRNA-Phe
  484. compost metagenome tRNA-Phe
  485. Proteus myxofaciens ATCC 19692 tRNA-Phe
  486. Cronobacter condimenti 1330 tRNA-Phe
  487. Cronobacter condimenti tRNA-Phe
  488. Cronobacter dublinensis subsp. dublinensis LMG 23823 tRNA-Phe
  489. Cronobacter dublinensis subsp. dublinensis tRNA-Phe
  490. Cronobacter dublinensis subsp. infanticibi tRNA-Phe
  491. Cronobacter dublinensis subsp. lactaridi LMG 23825 tRNA-Phe
  492. Cronobacter dublinensis subsp. lausannensis LMG 23824 tRNA-Phe
  493. Cronobacter dublinensis tRNA-Phe
  494. Cronobacter malonaticus ENBT0334 tRNA-Phe
  495. Cronobacter malonaticus LMG 23826 tRNA-Phe
  496. Cronobacter malonaticus tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  497. Cronobacter muytjensii ATCC 51329 tRNA-Phe
  498. Cronobacter muytjensii tRNA-Phe
  499. Cronobacter sakazakii ATCC BAA-894 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  500. Cronobacter sakazakii E899 tRNA-Phe
  501. Cronobacter sakazakii ES15 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  502. Cronobacter sakazakii tRNA-Phe
  503. Cronobacter sakazakii SP291 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  504. Cronobacter sp. 153480017-3 tRNA-Phe
  505. Cronobacter sp. EKM101R tRNA-Phe
  506. Cronobacter sp. HA18003 tRNA-Phe
  507. Cronobacter sp. HA18006 tRNA-Phe
  508. Cronobacter turicensis tRNA-Phe
  509. Cronobacter turicensis z3032 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  510. Cronobacter universalis NCTC 9529 tRNA-Phe
  511. Cronobacter universalis tRNA-Phe(gaa)
  512. Culicoides impunctatus tRNA-Phe(gaa)
  513. Dialister sp. tRNA-Phe
  514. Dickeya ananatis tRNA-Phe
  515. Dickeya chrysanthemi Ech1591 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  516. Dickeya chrysanthemi tRNA-Phe
  517. Dickeya dadantii 3937 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  518. Dickeya dadantii subsp. dieffenbachiae tRNA-Phe
  519. Dickeya dadantii tRNA-Phe
  520. Dickeya fangzhongdai tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  521. Dickeya lacustris tRNA-Phe
  522. Dickeya oryzae tRNA-Phe
  523. Dickeya parazeae Ech586 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  524. Dickeya parazeae tRNA-Phe
  525. Dickeya solani D s0432-1 tRNA-Phe
  526. Dickeya solani IPO 2222 tRNA-Phe
  527. Dickeya solani RNS 08.23.3.1.A tRNA-Phe
  528. Dickeya solani tRNA-Phe
  529. Dickeya ananatis Dickeya sp. A5391 tRNA-Phe
  530. Dickeya ananatis Dickeya sp. A5611 tRNA-Phe
  531. Dickeya ananatis Dickeya sp. A6136 tRNA-Phe
  532. Dickeya ananatis Dickeya sp. A6137 tRNA-Phe
  533. Dickeya ananatis Dickeya sp. CFBP 1272 tRNA-Phe
  534. Dickeya ananatis Dickeya sp. CFBP 1278 tRNA-Phe
  535. Dickeya sp. CFBP 2040 tRNA-Phe
  536. Dickeya undicola tRNA-Phe
  537. Dickeya undicola tRNA-Phe
  538. Dickeya poaceiphila tRNA-Phe
  539. Dickeya sp. tRNA-Phe
  540. Dickeya sp. ws52 tRNA-Phe
  541. Dickeya undicola tRNA-Phe
  542. Dickeya zeae EC1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  543. Dickeya zeae MS1 tRNA-Phe
  544. Dickeya zeae tRNA-Phe
  545. Dryocola boscaweniae tRNA-Phe
  546. Dryocola clanedunensis tRNA-Phe
  547. Dryocola sp. LX212 tRNA-Phe
  548. Edwardsiella anguillarum ET080813 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  549. Edwardsiella anguillarum tRNA-Phe
  550. Edwardsiella hoshinae tRNA-Phe(gaa)
  551. Edwardsiella ictaluri 93-146 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  552. Edwardsiella ictaluri tRNA-Phe(gaa)
  553. Edwardsiella piscicida C07-087 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  554. Edwardsiella piscicida EIB202 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  555. Edwardsiella piscicida tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  556. Edwardsiella sp. EA181011 tRNA-Phe
  557. Edwardsiella sp. LADL05-105 tRNA-Phe
  558. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Phe
  559. Edwardsiella tarda ATCC 23685 tRNA-Phe
  560. Edwardsiella tarda FL6-60 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  561. Edwardsiella tarda tRNA-Phe(gaa)
  562. Enterobacillus tribolii tRNA-Phe
  563. Enterobacter adelaidei tRNA-Phe
  564. Enterobacterales bacterium 8AC tRNA-Phe
  565. Enterobacterales bacterium tRNA-Phe
  566. Enterobacter asburiae L1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  567. Enterobacter asburiae tRNA-Phe
  568. Enterobacter bugandensis tRNA-Phe
  569. Enterobacter cancerogenus ATCC 35316 tRNA-Phe
  570. Enterobacter cancerogenus tRNA-Phe(gaa)
  571. Enterobacter chengduensis tRNA-Phe
  572. Enterobacter chinensis tRNA-Phe
  573. Enterobacter chuandaensis tRNA-Phe
  574. Enterobacter cloacae BIDMC 33A tRNA-Phe
  575. Enterobacter cloacae BIDMC 66 tRNA-Phe
  576. Enterobacter cloacae BIDMC 67 tRNA-Phe
  577. Enterobacter cloacae BIDMC 8 tRNA-Phe
  578. Enterobacter cloacae BWH 29 tRNA-Phe
  579. Enterobacter cloacae BWH 31 tRNA-Phe
  580. Enterobacter cloacae BWH 43 tRNA-Phe
  581. Enterobacter hormaechei subsp. hoffmannii Enterobacter cloacae complex 'Hoffmann cluster III' tRNA-Phe
  582. Enterobacter roggenkampii tRNA-Phe
  583. Enterobacter cloacae complex sp. 2021EL-01169 tRNA-Phe
  584. Enterobacter cloacae complex sp. 2021EL-01261 tRNA-Phe
  585. Enterobacter cloacae complex sp. 2022EL-00747 tRNA-Phe
  586. Enterobacter cloacae complex sp. 2022EL-00759 tRNA-Phe
  587. Enterobacter cloacae complex sp. 2022EL-00787 tRNA-Phe
  588. Enterobacter cloacae complex sp. 2022EL-00788 tRNA-Phe
  589. Enterobacter cloacae complex sp. 2022EL-00981 tRNA-Phe
  590. Enterobacter cloacae complex sp. 2022HL-01416 tRNA-Phe
  591. Enterobacter cloacae complex sp. 2023EL-00493 tRNA-Phe
  592. Enterobacter cloacae complex sp. 2023EL-00494 tRNA-Phe
  593. Enterobacter cloacae complex sp. 2023EL-00495 tRNA-Phe
  594. Enterobacter cloacae complex sp. 2023EL-00624 tRNA-Phe
  595. Enterobacter cloacae complex sp. 2023EL-00819 tRNA-Phe
  596. Enterobacter cloacae complex sp. 2023EL-00820 tRNA-Phe
  597. Enterobacter cloacae complex sp. 2023EL-00821 tRNA-Phe
  598. Enterobacter cloacae complex sp. 2023EL-01177 tRNA-Phe
  599. Enterobacter cloacae complex sp. 2024EL-00214 tRNA-Phe
  600. Enterobacter cloacae complex sp. 2024EL-00215 tRNA-Phe
  601. Enterobacter cloacae complex sp. 2024EL-00218 tRNA-Phe
  602. Enterobacter cloacae complex sp. 2024EL-00222 tRNA-Phe
  603. Enterobacter cloacae complex sp. 2024EL-00227 tRNA-Phe
  604. Enterobacter cloacae complex sp. 2024EL-00229 tRNA-Phe
  605. Enterobacter cloacae complex sp. 2024EL-00231 tRNA-Phe
  606. Enterobacter cloacae complex sp. 2024EL-00232 tRNA-Phe
  607. Enterobacter cloacae complex sp. 2024EL-00234 tRNA-Phe
  608. Enterobacter cloacae complex sp. 2024EL-00243 tRNA-Phe
  609. Enterobacter cloacae complex sp. 2024EL-00584 tRNA-Phe
  610. Enterobacter cloacae complex sp. 2024EL-00585 tRNA-Phe
  611. Enterobacter cloacae complex sp. 2024EL-00588 tRNA-Phe
  612. Enterobacter cloacae complex sp. 2024EL-00589 tRNA-Phe
  613. Enterobacter cloacae complex sp. 2024EL-00590 tRNA-Phe
  614. Enterobacter cloacae complex sp. 2024EL-00592 tRNA-Phe
  615. Enterobacter cloacae complex sp. 2024EL-00597 tRNA-Phe
  616. Enterobacter cloacae complex sp. 2024EL-00711 tRNA-Phe
  617. Enterobacter cloacae complex sp. 2024EL-00718 tRNA-Phe
  618. Enterobacter cloacae complex sp. 2024EL-00719 tRNA-Phe
  619. Enterobacter cloacae complex sp. 2024EL-00754 tRNA-Phe
  620. Enterobacter cloacae complex sp. 2024EL-00773 tRNA-Phe
  621. Enterobacter cloacae complex sp. 2024EL-00778 tRNA-Phe
  622. Enterobacter cloacae complex sp. 2024EL-00779 tRNA-Phe
  623. Enterobacter cloacae complex sp. 2024EL-00780 tRNA-Phe
  624. Enterobacter cloacae complex sp. 2024EL-00781 tRNA-Phe
  625. Enterobacter cloacae complex sp. 2024EL-00786 tRNA-Phe
  626. Enterobacter cloacae complex sp. 2025EL-00025 tRNA-Phe
  627. Enterobacter cloacae complex sp. 2025EL-00056 tRNA-Phe
  628. Enterobacter cloacae complex sp. 2025EL-00057 tRNA-Phe
  629. Enterobacter cloacae complex sp. 2025EL-00058 tRNA-Phe
  630. Enterobacter cloacae complex sp. 2025EL-00059 tRNA-Phe
  631. Enterobacter cloacae complex sp. 2025EL-00060 tRNA-Phe
  632. Enterobacter cloacae complex sp. 2025EL-00061 tRNA-Phe
  633. Enterobacter cloacae complex sp. 2025EL-00062 tRNA-Phe
  634. Enterobacter cloacae complex sp. 2025EL-00063 tRNA-Phe
  635. Enterobacter cloacae complex sp. 2025EL-00064 tRNA-Phe
  636. Enterobacter cloacae complex sp. 2025EL-00065 tRNA-Phe
  637. Enterobacter cloacae complex sp. 2025EL-00200 tRNA-Phe
  638. Enterobacter cloacae complex sp. 2025EL-00287 tRNA-Phe
  639. Enterobacter cloacae complex sp. 2DZ2F16B1 tRNA-Phe
  640. Enterobacter cloacae complex sp. 2DZ2F20B tRNA-Phe
  641. Enterobacter cloacae complex sp. 2DZ2F2B tRNA-Phe
  642. Enterobacter cloacae complex sp. 3DZ3S2B tRNA-Phe
  643. Enterobacter cloacae complex sp. 4DZ1-17B1 tRNA-Phe
  644. Enterobacter cloacae complex sp. 4DZ3-17B2 tRNA-Phe
  645. Enterobacter cloacae complex sp. 4DZ3-28B tRNA-Phe
  646. Enterobacter cloacae complex sp.6700005 tRNA-Phe
  647. Enterobacter cloacae complex sp.6700776 tRNA-Phe
  648. Enterobacter cloacae complex sp.6700816 tRNA-Phe
  649. Enterobacter cloacae complex sp.6701062 tRNA-Phe
  650. Enterobacter cloacae complex sp.6701430 tRNA-Phe
  651. Enterobacter cloacae complex sp.6701988 tRNA-Phe
  652. Enterobacter cloacae complex sp.6722787 tRNA-Phe
  653. Enterobacter cloacae complex sp.6722794 tRNA-Phe
  654. Enterobacter cloacae complex sp.6730051 tRNA-Phe
  655. Enterobacter cloacae complex sp.6730515 tRNA-Phe
  656. Enterobacter cloacae complex sp.6730552 tRNA-Phe
  657. Enterobacter cloacae complex sp.6730661 tRNA-Phe
  658. Enterobacter cloacae complex sp.6730722 tRNA-Phe
  659. Enterobacter cloacae complex sp.6730737 tRNA-Phe
  660. Enterobacter cloacae complex sp.6730764 tRNA-Phe
  661. Enterobacter cloacae complex sp.6730869 tRNA-Phe
  662. Enterobacter cloacae complex sp. 6730903 tRNA-Phe
  663. Enterobacter cloacae complex sp. 677-3DZ2D5B tRNA-Phe
  664. Enterobacter cloacae complex sp. 742-ADZ3-9B tRNA-Phe
  665. Enterobacter cloacae complex sp. 743-2DZ2F-22B tRNA-Phe
  666. Enterobacter cloacae complex sp. AR_0002 tRNA-Phe
  667. Enterobacter cloacae complex sp. BZL2001 tRNA-Phe
  668. Enterobacter cloacae complex sp. BZL2003 tRNA-Phe
  669. Enterobacter cloacae complex sp. BZL2004 tRNA-Phe
  670. Enterobacter cloacae complex sp. BZL2005 tRNA-Phe
  671. Enterobacter cloacae complex sp. CARB60 tRNA-Phe
  672. Enterobacter cloacae complex sp. CDL003 tRNA-Phe
  673. Enterobacter cloacae complex sp. CDL004 tRNA-Phe
  674. Enterobacter cloacae complex sp. CDL005 tRNA-Phe
  675. Enterobacter cloacae complex sp. CDL006 tRNA-Phe
  676. Enterobacter cloacae complex sp. CDL007 tRNA-Phe
  677. Enterobacter cloacae complex sp. CDL008 tRNA-Phe
  678. Enterobacter cloacae complex sp. CDL009 tRNA-Phe
  679. Enterobacter cloacae complex sp. CDL010 tRNA-Phe
  680. Enterobacter cloacae complex sp. CDL011 tRNA-Phe
  681. Enterobacter cloacae complex sp. CDL012 tRNA-Phe
  682. Enterobacter cloacae complex sp. CDL013 tRNA-Phe
  683. Enterobacter cloacae complex sp. CDL015 tRNA-Phe
  684. Enterobacter cloacae complex sp. CDL018 tRNA-Phe
  685. Enterobacter cloacae complex sp. CH23B tRNA-Phe
  686. Enterobacter cloacae complex sp. EB5 tRNA-Phe
  687. Enterobacter cloacae complex sp. E.c70 tRNA-Phe
  688. Enterobacter cloacae complex sp. ECC445 tRNA-Phe
  689. Enterobacter cloacae complex sp. ECL352 tRNA-Phe
  690. Enterobacter cloacae complex sp. ECL404 tRNA-Phe
  691. Enterobacter cloacae complex sp. ECL405 tRNA-Phe
  692. Enterobacter cloacae complex sp. ECL411 tRNA-Phe
  693. Enterobacter cloacae complex sp. ECL414 tRNA-Phe
  694. Enterobacter cloacae complex sp. ECNIH10 tRNA-Phe
  695. Enterobacter cloacae complex sp. ECNIH11 tRNA-Phe
  696. Enterobacter cloacae complex sp. ECNIH12 tRNA-Phe
  697. Enterobacter cloacae complex sp. ECNIH13 tRNA-Phe
  698. Enterobacter cloacae complex sp. ECNIH14 tRNA-Phe
  699. Enterobacter cloacae complex sp. ECNIH15 tRNA-Phe
  700. Enterobacter cloacae complex sp. ECNIH16 tRNA-Phe
  701. Enterobacter cloacae complex sp. ECNIH17 tRNA-Phe
  702. Enterobacter cloacae complex sp. ECNIH6 tRNA-Phe
  703. Enterobacter cloacae complex sp. ECNIH7 tRNA-Phe
  704. Enterobacter cloacae complex sp. ECNIH8 tRNA-Phe
  705. Enterobacter cloacae complex sp. ECNIH9 tRNA-Phe
  706. Enterobacter cloacae complex sp. FDA-CDC-AR_0132 tRNA-Phe
  707. Enterobacter cloacae complex sp. FDA-CDC-AR_0164 tRNA-Phe
  708. Enterobacter cloacae complex sp. FYR_6 tRNA-Phe
  709. Enterobacter cloacae complex sp. GF14B tRNA-Phe
  710. Enterobacter cloacae complex sp. GYL001 tRNA-Phe
  711. Enterobacter cloacae complex sp. GZL001 tRNA-Phe
  712. Enterobacter cloacae complex sp. HYC003_NIDB tRNA-Phe
  713. Enterobacter cloacae complex sp. HYC033_NIDB tRNA-Phe
  714. Enterobacter cloacae complex sp. HYC042_NIDB tRNA-Phe
  715. Enterobacter cloacae complex sp. HYC074_NIDB tRNA-Phe
  716. Enterobacter cloacae complex sp. HYC080_NIDB tRNA-Phe
  717. Enterobacter cloacae complex sp. I10 tRNA-Phe
  718. Enterobacter cloacae complex sp. I11 tRNA-Phe
  719. Enterobacter cloacae complex sp. I1M tRNA-Phe
  720. Enterobacter cloacae complex sp. I1 tRNA-Phe
  721. Enterobacter cloacae complex sp. I2 tRNA-Phe
  722. Enterobacter cloacae complex sp. I3 tRNA-Phe
  723. Enterobacter cloacae complex sp. I4 tRNA-Phe
  724. Enterobacter cloacae complex sp. I5 tRNA-Phe
  725. Enterobacter cloacae complex sp. I6 tRNA-Phe
  726. Enterobacter cloacae complex sp. I7 tRNA-Phe
  727. Enterobacter cloacae complex sp. I8 tRNA-Phe
  728. Enterobacter cloacae complex sp. I9 tRNA-Phe
  729. Enterobacter cloacae complex sp. IR1532 tRNA-Phe
  730. Enterobacter cloacae complex sp. IR5283 tRNA-Phe
  731. Enterobacter cloacae complex sp. IR53030 tRNA-Phe
  732. Enterobacter cloacae complex sp. IR53041 tRNA-Phe
  733. Enterobacter cloacae complex sp. IR53043 tRNA-Phe
  734. Enterobacter cloacae complex sp. IR5374 tRNA-Phe
  735. Enterobacter cloacae complex sp. IR5376 tRNA-Phe
  736. Enterobacter cloacae complex sp. IR5378 tRNA-Phe
  737. Enterobacter cloacae complex sp. IR5379 tRNA-Phe
  738. Enterobacter cloacae complex sp. IR5381 tRNA-Phe
  739. Enterobacter cloacae complex sp. IR5382 tRNA-Phe
  740. Enterobacter cloacae complex sp. IR5384 tRNA-Phe
  741. Enterobacter cloacae complex sp. IR5385 tRNA-Phe
  742. Enterobacter cloacae complex sp. IR5390 tRNA-Phe
  743. Enterobacter cloacae complex sp. IR5399 tRNA-Phe
  744. Enterobacter cloacae complex sp. IR5401 tRNA-Phe
  745. Enterobacter cloacae complex sp. IR5402 tRNA-Phe
  746. Enterobacter cloacae complex sp. IR5403 tRNA-Phe
  747. Enterobacter cloacae complex sp. IR5412 tRNA-Phe
  748. Enterobacter cloacae complex sp. IR5414 tRNA-Phe
  749. Enterobacter cloacae complex sp. IR5418 tRNA-Phe
  750. Enterobacter cloacae complex sp. IR5422 tRNA-Phe
  751. Enterobacter cloacae complex sp. IR5424 tRNA-Phe
  752. Enterobacter cloacae complex sp. IR5428 tRNA-Phe
  753. Enterobacter cloacae complex sp. IR5433 tRNA-Phe
  754. Enterobacter cloacae complex sp. IR5434 tRNA-Phe
  755. Enterobacter cloacae complex sp. IR5435 tRNA-Phe
  756. Enterobacter cloacae complex sp. IR5437 tRNA-Phe
  757. Enterobacter cloacae complex sp. IR5441 tRNA-Phe
  758. Enterobacter cloacae complex sp. IR5448 tRNA-Phe
  759. Enterobacter cloacae complex sp. IR5450 tRNA-Phe
  760. Enterobacter cloacae complex sp. IR5453 tRNA-Phe
  761. Enterobacter cloacae complex sp. IR5457 tRNA-Phe
  762. Enterobacter cloacae complex sp. IR5458 tRNA-Phe
  763. Enterobacter cloacae complex sp. IR5459 tRNA-Phe
  764. Enterobacter cloacae complex sp. IR5462 tRNA-Phe
  765. Enterobacter cloacae complex sp. IR5476 tRNA-Phe
  766. Enterobacter cloacae complex sp. JNL001 tRNA-Phe
  767. Enterobacter cloacae complex sp. LZL001 tRNA-Phe
  768. Enterobacter cloacae complex sp. LZL002 tRNA-Phe
  769. Enterobacter cloacae complex sp. LZL003 tRNA-Phe
  770. Enterobacter cloacae complex sp. LZL004 tRNA-Phe
  771. Enterobacter cloacae complex sp. LZL005 tRNA-Phe
  772. Enterobacter cloacae complex sp. Mu1197 tRNA-Phe
  773. Enterobacter cloacae complex sp. OE43NF tRNA-Phe
  774. Enterobacter cloacae complex sp. P10RS tRNA-Phe
  775. Enterobacter cloacae complex sp. P11RS tRNA-Phe
  776. Enterobacter cloacae complex sp. P12RS tRNA-Phe
  777. Enterobacter cloacae complex sp. P13B tRNA-Phe
  778. Enterobacter cloacae complex sp. P13RS tRNA-Phe
  779. Enterobacter cloacae complex sp. P14RS tRNA-Phe
  780. Enterobacter cloacae complex sp. P15RS tRNA-Phe
  781. Enterobacter cloacae complex sp. P16RS2 tRNA-Phe
  782. Enterobacter cloacae complex sp. P17RS tRNA-Phe
  783. Enterobacter cloacae complex sp. P18RS tRNA-Phe
  784. Enterobacter cloacae complex sp. P1B tRNA-Phe
  785. Enterobacter cloacae complex sp. P20B tRNA-Phe
  786. Enterobacter cloacae complex sp. P20C tRNA-Phe
  787. Enterobacter cloacae complex sp. P21C tRNA-Phe
  788. Enterobacter cloacae complex sp. P21RS tRNA-Phe
  789. Enterobacter cloacae complex sp. P22RS tRNA-Phe
  790. Enterobacter cloacae complex sp. P23RS tRNA-Phe
  791. Enterobacter cloacae complex sp. P24RS tRNA-Phe
  792. Enterobacter cloacae complex sp. P25RS tRNA-Phe
  793. Enterobacter cloacae complex sp. P26RS tRNA-Phe
  794. Enterobacter cloacae complex sp. P27C tRNA-Phe
  795. Enterobacter cloacae complex sp. P28RS tRNA-Phe
  796. Enterobacter cloacae complex sp. P29RS tRNA-Phe
  797. Enterobacter cloacae complex sp. P2B tRNA-Phe
  798. Enterobacter cloacae complex sp. P30BA tRNA-Phe
  799. Enterobacter cloacae complex sp. P30U tRNA-Phe
  800. Enterobacter cloacae complex sp. P31C tRNA-Phe
  801. Enterobacter cloacae complex sp. P32C tRNA-Phe
  802. Enterobacter cloacae complex sp. P33B tRNA-Phe
  803. Enterobacter cloacae complex sp. P34C tRNA-Phe
  804. Enterobacter cloacae complex sp. P35B tRNA-Phe
  805. Enterobacter cloacae complex sp. P36RS tRNA-Phe
  806. Enterobacter cloacae complex sp. P37RS tRNA-Phe
  807. Enterobacter cloacae complex sp. P38RS tRNA-Phe
  808. Enterobacter cloacae complex sp. P39RS tRNA-Phe
  809. Enterobacter cloacae complex sp. P3B tRNA-Phe
  810. Enterobacter cloacae complex sp. P40C2 tRNA-Phe
  811. Enterobacter cloacae complex sp. P40C tRNA-Phe
  812. Enterobacter cloacae complex sp. P41C tRNA-Phe
  813. Enterobacter cloacae complex sp. P41RS tRNA-Phe
  814. Enterobacter cloacae complex sp. P42C tRNA-Phe
  815. Enterobacter cloacae complex sp. P42RS tRNA-Phe
  816. Enterobacter cloacae complex sp. P43RS tRNA-Phe
  817. Enterobacter cloacae complex sp. P44RS tRNA-Phe
  818. Enterobacter cloacae complex sp. P45RS tRNA-Phe
  819. Enterobacter cloacae complex sp. P46RS tRNA-Phe
  820. Enterobacter cloacae complex sp. P47BA tRNA-Phe
  821. Enterobacter cloacae complex sp. P4RS tRNA-Phe
  822. Enterobacter cloacae complex sp. P5RS tRNA-Phe
  823. Enterobacter cloacae complex sp. P6RS tRNA-Phe
  824. Enterobacter cloacae complex sp. P8BA tRNA-Phe
  825. Enterobacter cloacae complex sp. P8RS tRNA-Phe
  826. Enterobacter cloacae complex sp. P9RS tRNA-Phe
  827. Enterobacter cloacae complex sp. RIVM_C039474 tRNA-Phe
  828. Enterobacter cloacae complex sp. S1 tRNA-Phe
  829. Enterobacter cloacae complex sp. S2 tRNA-Phe
  830. Enterobacter cloacae complex sp. S3 tRNA-Phe
  831. Enterobacter cloacae complex sp. S4 tRNA-Phe
  832. Enterobacter cloacae complex sp. SHL001 tRNA-Phe
  833. Enterobacter cloacae complex sp. SHL002 tRNA-Phe
  834. Enterobacter cloacae complex sp. SHL004 tRNA-Phe
  835. Enterobacter cloacae complex sp. SHL005 tRNA-Phe
  836. Enterobacter cloacae complex sp. SHL006 tRNA-Phe
  837. Enterobacter cloacae complex sp. SHL007 tRNA-Phe
  838. Enterobacter cloacae complex sp. SHL008 tRNA-Phe
  839. Enterobacter cloacae complex sp. SHL009 tRNA-Phe
  840. Enterobacter cloacae complex sp. SHL010 tRNA-Phe
  841. Enterobacter cloacae complex sp. SHL011 tRNA-Phe
  842. Enterobacter cloacae complex sp. SHL012 tRNA-Phe
  843. Enterobacter cloacae complex sp. SHL014 tRNA-Phe
  844. Enterobacter cloacae complex sp. SHL015 tRNA-Phe
  845. Enterobacter cloacae complex sp. SHL016 tRNA-Phe
  846. Enterobacter cloacae complex sp. SHL017 tRNA-Phe
  847. Enterobacter cloacae complex sp. SHL018 tRNA-Phe
  848. Enterobacter cloacae complex sp. SHL020 tRNA-Phe
  849. Enterobacter cloacae complex sp. SHL021 tRNA-Phe
  850. Enterobacter cloacae complex sp. SHL022 tRNA-Phe
  851. Enterobacter cloacae complex sp. SYL001 tRNA-Phe
  852. Enterobacter cloacae complex sp. SYL002 tRNA-Phe
  853. Enterobacter cloacae complex sp. SYL003 tRNA-Phe
  854. Enterobacter cloacae complex sp. SYL004 tRNA-Phe
  855. Enterobacter cloacae complex sp. TREC1 tRNA-Phe
  856. Enterobacter cloacae complex sp. tRNA-Phe
  857. Enterobacter cloacae complex sp. XAL001 tRNA-Phe
  858. Enterobacter cloacae complex sp. XAL002 tRNA-Phe
  859. Enterobacter cloacae complex sp. XAL003 tRNA-Phe
  860. Enterobacter cloacae complex sp. XAL004 tRNA-Phe
  861. Enterobacter cloacae complex sp. XJL001 tRNA-Phe
  862. Enterobacter cloacae complex sp. XJL002 tRNA-Phe
  863. Enterobacter cloacae complex sp. XJL003 tRNA-Phe
  864. Enterobacter cloacae complex sp. XJL004 tRNA-Phe
  865. Enterobacter cloacae complex sp. YD19/O97A5 tRNA-Phe
  866. Enterobacter cloacae complex sp. YD24/O97A9 tRNA-Phe
  867. Enterobacter cloacae complex sp. YD70/O97D2 tRNA-Phe
  868. Enterobacter cloacae complex sp. zbq_7 tRNA-Phe
  869. Enterobacter cloacae complex sp. zbq_8 tRNA-Phe
  870. Enterobacter cloacae complex sp. zbq_9 tRNA-Phe
  871. Enterobacter cloacae complex sp. ZZL001 tRNA-Phe
  872. Enterobacter cloacae complex sp. ZZL003 tRNA-Phe
  873. Enterobacter cloacae complex sp. ZZL004 tRNA-Phe
  874. Enterobacter cloacae complex sp. ZZL005 tRNA-Phe
  875. Enterobacter cloacae ECNIH2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  876. Enterobacter cloacae MGH 53 tRNA-Phe
  877. Enterobacter cloacae MRSN 11489 tRNA-Phe
  878. Enterobacter cloacae S611 tRNA-Phe
  879. Enterobacter cloacae str. Hanford tRNA-Phe
  880. Enterobacter cloacae subsp. cloacae ATCC 13047 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  881. Enterobacter cloacae subsp. cloacae GS1 tRNA-Phe
  882. Enterobacter cloacae subsp. cloacae tRNA-Phe(gaa)
  883. Enterobacter cloacae subsp. dissolvens SDM tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  884. Enterobacter cloacae subsp. dissolvens tRNA-Phe
  885. Enterobacter cloacae tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  886. Enterobacter cloacae UCI 23 tRNA-Phe
  887. Enterobacter cloacae UCI 24 tRNA-Phe
  888. Enterobacter cloacae UCI 29 tRNA-Phe
  889. Enterobacter cloacae UCI 30 tRNA-Phe
  890. Enterobacter cloacae UCI 35 tRNA-Phe
  891. Enterobacter cloacae UCI 36 tRNA-Phe
  892. Enterobacter cloacae UCI 49 tRNA-Phe
  893. Enterobacter cloacae UCICRE 11 tRNA-Phe
  894. Enterobacter cloacae UCICRE 12 tRNA-Phe
  895. Enterobacter cloacae UCICRE 5 tRNA-Phe
  896. Enterobacter dykesii tRNA-Phe
  897. Enterobacter genomosp. O tRNA-Phe
  898. Enterobacter genomosp. S tRNA-Phe
  899. Enterobacter hormaechei ATCC 49162 tRNA-Phe
  900. Enterobacter hormaechei subsp. hoffmannii ECNIH3 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  901. Enterobacter hormaechei subsp. hoffmannii ECR091 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  902. Enterobacter hormaechei subsp. hoffmannii MGH 13 tRNA-Phe
  903. Enterobacter hormaechei subsp. hoffmannii MRSN 11248 tRNA-Phe
  904. Enterobacter hormaechei subsp. hoffmannii UCI 50 tRNA-Phe
  905. Enterobacter hormaechei subsp. hoffmannii UCICRE 3 tRNA-Phe
  906. Enterobacter hormaechei subsp. hoffmannii UCICRE 9 tRNA-Phe
  907. Enterobacter hormaechei subsp. hormaechei tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  908. Enterobacter hormaechei subsp. oharae tRNA-Phe
  909. Enterobacter hormaechei subsp. steigerwaltii tRNA-Phe
  910. Enterobacter hormaechei subsp. xiangfangensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  911. Enterobacter hormaechei tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  912. Enterobacter huaxiensis tRNA-Phe
  913. Enterobacteriaceae bacterium 8376wB8 tRNA-Phe
  914. Enterobacteriaceae bacterium 8376wB9 tRNA-Phe
  915. Enterobacteriaceae bacterium 8376wD7 tRNA-Phe
  916. Enterobacteriaceae bacterium 8376wD8 tRNA-Phe
  917. Enterobacteriaceae bacterium 8376wD9 tRNA-Phe
  918. Enterobacteriaceae bacterium 8376wG6 tRNA-Phe
  919. Enterobacteriaceae bacterium 8376wH8 tRNA-Phe
  920. Enterobacteriaceae bacterium 89 tRNA-Phe
  921. Enterobacteriaceae bacterium 9_2_54FAA tRNA-Phe
  922. Enterobacteriaceae bacterium A-F18 tRNA-Phe
  923. Enterobacteriaceae bacterium ATCC 29904 tRNA-Phe
  924. Enterobacteriaceae bacterium C23F tRNA-Phe
  925. Enterobacteriaceae bacterium C34A tRNA-Phe
  926. Enterobacteriaceae bacterium C34B tRNA-Phe
  927. Enterobacteriaceae bacterium C34L tRNA-Phe
  928. Apirhabdus apintestini Enterobacteriaceae bacterium CA-0114 tRNA-Phe
  929. Enterobacteriaceae bacterium CCUG 67584 tRNA-Phe
  930. Enterobacteriaceae bacterium DFI.7.85 tRNA-Phe
  931. Enterobacteriaceae bacterium ENNIH1 tRNA-Phe
  932. Enterobacteriaceae bacterium ENNIH2 tRNA-Phe
  933. Enterobacteriaceae bacterium ENNIH3 tRNA-Phe
  934. Enterobacteriaceae bacterium G50 tRNA-Phe
  935. Enterobacteriaceae bacterium MCC505 tRNA-Phe
  936. Enterobacteriaceae bacterium RIT691 tRNA-Phe
  937. Enterobacteriaceae bacterium RIT693 tRNA-Phe
  938. Enterobacteriaceae bacterium RIT711 tRNA-Phe
  939. Enterobacteriaceae bacterium RIT714 tRNA-Phe
  940. Enterobacteriaceae bacterium RIT 814 tRNA-Phe
  941. Enterobacteriaceae bacterium S05 tRNA-Phe
  942. Enterobacteriaceae bacterium S18_ASV_15 tRNA-Phe
  943. Enterobacteriaceae bacterium S22_ASV_15 tRNA-Phe
  944. Enterobacteriaceae bacterium S29_ASV_15 tRNA-Phe
  945. Enterobacteriaceae bacterium S32_ASV_15 tRNA-Phe
  946. Enterobacteriaceae bacterium S5_ASV_15 tRNA-Phe
  947. Enterobacteriaceae bacterium strain FGI 57 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  948. Enterobacteriaceae bacterium tRNA-Phe
  949. Enterobacteriaceae bacterium TYF_5 tRNA-Phe
  950. Enterobacteriaceae bacterium TzEc013 tRNA-Phe
  951. Enterobacteriaceae bacterium TzEc051 tRNA-Phe
  952. Enterobacteriaceae bacterium TzEc052 tRNA-Phe
  953. Enterobacteriaceae bacterium TzEc058 tRNA-Phe
  954. Enterobacteriaceae bacterium TzEc077 tRNA-Phe
  955. Enterobacteriaceae bacterium TzEc084 tRNA-Phe
  956. Acerihabitans arboris tRNA-Phe
  957. Enterobacter intestinihominis tRNA-Phe(gaa)
  958. Enterobacter kobei tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  959. [Enterobacter] lignolyticus SCF1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  960. [Enterobacter] lignolyticus tRNA-Phe
  961. Enterobacter ludwigii tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  962. Enterobacter mori tRNA-Phe(gaa)
  963. Enterobacter nematophilus tRNA-Phe
  964. Enterobacter oligotrophicus tRNA-Phe
  965. Enterobacter pasteurii tRNA-Phe
  966. Enterobacter pseudoroggenkampii tRNA-Phe
  967. Enterobacter quasimori tRNA-Phe
  968. Enterobacter quasiroggenkampii tRNA-Phe
  969. Enterobacter roggenkampii CHS 79 tRNA-Phe
  970. Enterobacter roggenkampii EC_38VIM1 tRNA-Phe
  971. Enterobacter roggenkampii MGH 34 tRNA-Phe
  972. Enterobacter roggenkampii MGH 54 tRNA-Phe
  973. Enterobacter roggenkampii UCI 39 tRNA-Phe
  974. Enterobacter rongchengensis tRNA-Phe(gaa)
  975. Enterobacter sichuanensis tRNA-Phe
  976. Enterobacter soli ATCC BAA-2102 tRNA-Phe
  977. Enterobacter soli tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  978. Enterobacter sp. 01-M-01-SI-ECC_S143 tRNA-Phe
  979. Enterobacter sp. 01-M-01-SI-ECC tRNA-Phe
  980. Enterobacter sp. 01-M-02-AD-ECC tRNA-Phe
  981. Enterobacter sp. 01-M-02-PA-ECC tRNA-Phe
  982. Enterobacter sp. 01-M-02-RE-ECC tRNA-Phe
  983. Enterobacter sp. 01-M-02-SI-ECC tRNA-Phe
  984. Enterobacter sp. 01-M-03-SI-ECC_S142 tRNA-Phe
  985. Enterobacter sp. 01-M-03-SI-ECC tRNA-Phe
  986. Enterobacter sp. 01-M-05-SI-ECC tRNA-Phe
  987. Enterobacter sp. 03-F-07-AD-ECC tRNA-Phe
  988. Enterobacter sp. 03-F-08-SI-ECC tRNA-Phe
  989. Enterobacter sp. 04-C-01-SI-ECC tRNA-Phe
  990. Enterobacter sp. 04-C-01-SI_S15 tRNA-Phe
  991. Enterobacter sp. 04-C-04-SI-ECC tRNA-Phe
  992. Enterobacter sp. 04-C-06-SI-ECC tRNA-Phe
  993. Enterobacter sp. 04-C-07-SI-ECC tRNA-Phe
  994. Enterobacter sp. 04-C-08-SI-ECC tRNA-Phe
  995. Enterobacter sp. 04-C-12-SI-ECC tRNA-Phe
  996. Enterobacter sp. 10-1 tRNA-Phe
  997. Enterobacter sp. 10-H-06-PA-ECC tRNA-Phe
  998. Enterobacter sp. 120016 tRNA-Phe
  999. Enterobacter sp. 155105 tRNA-Phe
  1000. Enterobacter sp. 186315 tRNA-Phe
  1001. Enterobacter sp. 18A13 tRNA-Phe
  1002. Enterobacter sp. 198 tRNA-Phe
  1003. Enterobacter sp. 200527-13 tRNA-Phe
  1004. Enterobacter sp. 20B5 tRNA-Phe
  1005. Enterobacter sp. 22104 tRNA-Phe
  1006. Enterobacter sp. 22146 tRNA-Phe
  1007. Enterobacter sp. 22325 tRNA-Phe
  1008. Enterobacter sp. 22452 tRNA-Phe
  1009. Enterobacter sp. 22466 tRNA-Phe
  1010. Enterobacter sp. 22499 tRNA-Phe
  1011. Enterobacter sp. 22503 tRNA-Phe
  1012. Enterobacter sp. 22696 tRNA-Phe
  1013. Enterobacter sp. 23-M-SZ-13 tRNA-Phe
  1014. Enterobacter sp. 301B tRNA-Phe
  1015. Enterobacter sp. 3U4 tRNA-Phe
  1016. Enterobacter sp. 4974935 tRNA-Phe
  1017. Enterobacter sp. 50588862 tRNA-Phe
  1018. Enterobacter sp. 50793107 tRNA-Phe
  1019. Enterobacter sp. 50858885 tRNA-Phe
  1020. Enterobacter sp. 56-7 tRNA-Phe
  1021. Enterobacter sp. 638 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1022. Enterobacter sp. 63 tRNA-Phe
  1023. Enterobacter sp. 6678285 tRNA-Phe
  1024. Enterobacter sp. 6722112 tRNA-Phe
  1025. Enterobacter sp. 6722171 tRNA-Phe
  1026. Enterobacter sp. 6722177 tRNA-Phe
  1027. Enterobacter sp. 6722181 tRNA-Phe
  1028. Enterobacter sp. 725m/11 tRNA-Phe
  1029. Enterobacter sp. 9-2 tRNA-Phe
  1030. Enterobacter sp. A103 tRNA-Phe
  1031. Enterobacter sp. A11 tRNA-Phe
  1032. Enterobacter sp. A4 tRNA-Phe
  1033. Enterobacter sp. ABFQC tRNA-Phe
  1034. Enterobacter sp. AC1 tRNA-Phe
  1035. Enterobacter sp. Acro-832 tRNA-Phe
  1036. Enterobacter sp. AD2-3 tRNA-Phe
  1037. Enterobacter sp. Ag1 tRNA-Phe
  1038. Enterobacter sp. AM17-18 tRNA-Phe
  1039. Enterobacter sp. AN-K1 tRNA-Phe
  1040. Enterobacter sp. Ap-1006 tRNA-Phe
  1041. Enterobacter sp. Ap-867 tRNA-Phe
  1042. Enterobacter sp. Ap-916 tRNA-Phe
  1043. Enterobacter sp. APAP_BS8 tRNA-Phe
  1044. Enterobacter sp. AS-1 tRNA-Phe
  1045. Enterobacter sp. ASE tRNA-Phe
  1046. Enterobacter sp. B79-1 tRNA-Phe
  1047. Enterobacter sp. BA-045-C-ECC tRNA-Phe
  1048. Enterobacter sp. BB-069-C-ECC tRNA-Phe
  1049. Enterobacter sp. BB-069-C_S2 tRNA-Phe
  1050. Enterobacter sp. BH2-YP2023 tRNA-Phe
  1051. Enterobacter sp. BIDMC100 tRNA-Phe
  1052. Enterobacter sp. BIDMC109 tRNA-Phe
  1053. Enterobacter sp. BIDMC110 tRNA-Phe
  1054. Enterobacter sp. BIDMC 26 tRNA-Phe
  1055. Enterobacter sp. BIDMC 27 tRNA-Phe
  1056. Enterobacter sp. BIDMC 28 tRNA-Phe
  1057. Enterobacter sp. BIDMC 29 tRNA-Phe
  1058. Enterobacter sp. BIDMC 30 tRNA-Phe
  1059. Enterobacter sp. BIDMC87 tRNA-Phe
  1060. Enterobacter sp. BIDMC92 tRNA-Phe
  1061. Enterobacter sp. BIDMC93 tRNA-Phe
  1062. Enterobacter sp. BIDMC94 tRNA-Phe
  1063. Enterobacter sp. BIDMC99 tRNA-Phe
  1064. Enterobacter sp. BIGb0239 tRNA-Phe
  1065. Enterobacter sp. BNK-13 tRNA-Phe
  1066. Enterobacter sp. BNK-14 tRNA-Phe
  1067. Enterobacter sp. BNK-16 tRNA-Phe
  1068. Enterobacter sp. BNK-18 tRNA-Phe
  1069. Enterobacter sp. BNK-22 tRNA-Phe
  1070. Enterobacter sp. BNK-29 tRNA-Phe
  1071. Enterobacter sp. BNK-32 tRNA-Phe
  1072. Enterobacter sp. BNK-34 tRNA-Phe
  1073. Enterobacter sp. BT1131 tRNA-Phe
  1074. Enterobacter sp. BT1268 tRNA-Phe
  1075. Enterobacter sp. BT1271 tRNA-Phe
  1076. Enterobacter sp. BT223 tRNA-Phe
  1077. Enterobacter sp. BT4 tRNA-Phe
  1078. Enterobacter sp. BT855 tRNA-Phe
  1079. Enterobacter sp. BWH 27 tRNA-Phe
  1080. Enterobacter sp. BWH 37 tRNA-Phe
  1081. Enterobacter sp. BWH 39 tRNA-Phe
  1082. Enterobacter sp. BWH52 tRNA-Phe
  1083. Enterobacter sp. BWH63 tRNA-Phe
  1084. Enterobacter sp. BWH64 tRNA-Phe
  1085. Enterobacter sp. C4G1 tRNA-Phe
  1086. Enterobacter sp. C6 tRNA-Phe
  1087. Enterobacter sp. CC120223-11 tRNA_Phe_GAA
  1088. Enterobacter hoffmannii subsp. nototheniae Enterobacter sp. CCM 8629 tRNA-Phe
  1089. Enterobacter hormaechei subsp. hoffmannii Enterobacter sp. CCM 8630 tRNA-Phe
  1090. Enterobacter sp. CCUG 70166 tRNA-Phe
  1091. Enterobacter sp. CFEC121 tRNA-Phe
  1092. Enterobacter sp. CFEC122 tRNA-Phe
  1093. Enterobacter sp. CFEC141 tRNA-Phe
  1094. Enterobacter sp. CFEC93 tRNA-Phe
  1095. Enterobacter sp. CM29 tRNA-Phe
  1096. Enterobacter sp. CP102 tRNA-Phe
  1097. Enterobacter sp. Crenshaw tRNA-Phe
  1098. Enterobacter sp. CRENT-193 tRNA-Phe
  1099. Enterobacter sp. CT-015-C-ECC tRNA-Phe
  1100. Enterobacter sp. Cy-1797 tRNA-Phe
  1101. Enterobacter sp. Cy-643 tRNA-Phe
  1102. Enterobacter sp. D2 tRNA-Phe
  1103. Enterobacter sp. DC1 tRNA-Phe
  1104. Enterobacter sp. DC3 tRNA-Phe
  1105. Enterobacter sp. DC4 tRNA-Phe
  1106. Enterobacter sp. DNRA5 tRNA-Phe
  1107. Enterobacter sp. DN tRNA-Phe
  1108. Enterobacter sp. DRP3 tRNA-Phe
  1109. Enterobacter sp. DS-006-C-ECC tRNA-Phe
  1110. unidentified tRNA-Phe
  1111. Enterobacter sp. DTU_2021_1002640_1_SI_PRY_ASU_LCPMC_013 tRNA-Phe
  1112. Enterobacter sp. E12 tRNA-Phe
  1113. Enterobacter sp. E14S tRNA-Phe
  1114. Enterobacter sp. E1 tRNA-Phe
  1115. Enterobacter sp. E20 tRNA-Phe
  1116. Enterobacter sp. E76 tRNA-Phe
  1117. Enterobacter sp. EA-1 tRNA-Phe
  1118. Enterobacter sp. EC_50 tRNA-Phe
  1119. Enterobacter sp. EC_62 tRNA-Phe
  1120. Enterobacter sp. EC_64 tRNA-Phe
  1121. Enterobacter sp. ECC-019 tRNA-Phe
  1122. Enterobacter sp. ECC-175 tRNA-Phe
  1123. Enterobacter sp. ECC_219_Taxon_10 tRNA-Phe
  1124. Enterobacter sp. ECC-219 tRNA-Phe
  1125. Enterobacter sp. ECC-249 tRNA-Phe
  1126. Enterobacter sp. EC-ML559 tRNA-Phe
  1127. Enterobacter sp. EC-ML 621 tRNA-Phe
  1128. Enterobacter sp. EC-NT1 tRNA-Phe
  1129. Enterobacter sp. EGD-HP1 tRNA-Phe
  1130. Enterobacter sp. ENT02 tRNA-Phe
  1131. Enterobacter sp. ENT03 tRNA-Phe
  1132. Enterobacter sp. ES001 tRNA-Phe
  1133. Enterobacter sp. ESY66 tRNA-Phe
  1134. Enterobacter sp. ESY93 tRNA-Phe
  1135. Enterobacter sp. FB tRNA-Phe
  1136. Enterobacter sp. fkY84-1 tRNA-Phe
  1137. Enterobacter sp. fkY84-4 tRNA-Phe
  1138. Enterobacter sp. FL1277 tRNA-Phe
  1139. Enterobacter sp. FR 78 tRNA-Phe
  1140. Enterobacter sp. FS01 tRNA-Phe
  1141. Enterobacter sp. FUJ80071 tRNA-Phe
  1142. Enterobacter sp. FW301-JW63 tRNA-Phe
  1143. Enterobacter sp. FW301-JW81 tRNA-Phe
  1144. Enterobacter sp. FY-07 tRNA-Phe
  1145. Enterobacter sp. GD03975 tRNA-Phe
  1146. Enterobacter sp. GER_MD16_1505_Eko_090 tRNA-Phe
  1147. Enterobacter sp. GI-020-C-ECC tRNA-Phe
  1148. Enterobacter sp. GM-22 tRNA-Phe
  1149. Enterobacter sp. GM-31 tRNA-Phe
  1150. Citrobacter braakii tRNA-Phe
  1151. Enterobacter sp. H2G27 tRNA-Phe
  1152. Enterobacter sp. HA-027-I-ECC tRNA-Phe
  1153. Enterobacter sp. HG048 tRNA-Phe
  1154. Enterobacter sp. HK-058-C-ECC tRNA-Phe
  1155. Enterobacter sp. HK169 tRNA-Phe
  1156. Enterobacter sp. HMSC055A11 tRNA-Phe
  1157. Enterobacter sp. HMSC16D10 tRNA-Phe
  1158. Enterobacter sp. HN503E2II tRNA-Phe
  1159. Enterobacter sp. HNDS-6 tRNA-Phe
  1160. Enterobacter sp. HNGD-822 tRNA-Phe
  1161. Enterobacter sp. HP146 tRNA-Phe
  1162. Enterobacter sp. HP165 tRNA-Phe
  1163. Enterobacter sp. HP182 tRNA-Phe
  1164. Enterobacter sp. HP65 tRNA-Phe
  1165. Enterobacter sp. HP80 tRNA-Phe
  1166. Enterobacter sp. HPCN14 tRNA-Phe
  1167. Enterobacter sp. HSTU-ASh6 tRNA-Phe
  1168. Enterobacter sp. I4 tRNA-Phe
  1169. Enterobacter sp. IBGEEm25P6 tRNA-Phe
  1170. Enterobacter sp. J49 tRNA-Phe
  1171. Enterobacter sp. J706 tRNA-Phe
  1172. Enterobacter sp. JBIWA003 tRNA-Phe
  1173. Enterobacter sp. JBIWA005 tRNA-Phe
  1174. Enterobacter sp. JBIWA008 tRNA-Phe
  1175. Enterobacter sp. JGM127 tRNA-Phe
  1176. Enterobacter sp. JJBC tRNA-Phe
  1177. Enterobacter sp. JMULE2 tRNA-Phe
  1178. Enterobacter sp. JS8-1 tRNA-Phe
  1179. Enterobacter sp. JUb101 tRNA-Phe
  1180. Enterobacter sp. JUb54 tRNA-Phe
  1181. Enterobacter sp. K62_1 tRNA-Phe
  1182. Enterobacter sp. K66-74 tRNA-Phe
  1183. Enterobacter sp. KB-221C9 tRNA-Phe
  1184. Enterobacter sp. KB-280D8 tRNA-Phe
  1185. Enterobacter sp. KBR-315C3_2022 tRNA-Phe
  1186. Enterobacter sp. KE9933 tRNA-Phe
  1187. Enterobacter sp. kpr-6 tRNA_Phe_GAA
  1188. Enterobacter sp. ku-bf2 tRNA-Phe
  1189. Enterobacter sp. L710-11 tRNA-Phe
  1190. Enterobacter sp. L710-12 tRNA-Phe
  1191. Enterobacter sp. L710-1 tRNA-Phe
  1192. Enterobacter sp. L710-20 tRNA-Phe
  1193. Enterobacter sp. L710-92 tRNA-Phe
  1194. Enterobacter sp. Li2LvB3 tRNA-Phe
  1195. Enterobacter sp. LM-065-I-ECC tRNA-Phe
  1196. Enterobacter sp. LM3 tRNA-Phe
  1197. Enterobacter sp. LR6 tRNA-Phe
  1198. Enterobacter sp. LU1 tRNA-Phe
  1199. Enterobacter sp. Lyrl_3 tRNA-Phe
  1200. Enterobacter sp. M4-VN tRNA-Phe
  1201. Enterobacter sp. M607 tRNA-Phe
  1202. Enterobacter sp. MF024 tRNA-Phe
  1203. Enterobacter sp. MG-EB028 tRNA-Phe
  1204. Enterobacter sp. MGH 10 tRNA-Phe
  1205. Enterobacter sp. MGH119 tRNA-Phe
  1206. Enterobacter sp. MGH 11 tRNA-Phe
  1207. Enterobacter sp. MGH120 tRNA-Phe
  1208. Enterobacter sp. MGH127 tRNA-Phe
  1209. Enterobacter sp. MGH128 tRNA-Phe
  1210. Enterobacter sp. MGH 12 tRNA-Phe
  1211. Enterobacter sp. MGH 14 tRNA-Phe
  1212. Enterobacter sp. MGH 15 tRNA-Phe
  1213. Enterobacter sp. MGH 16 tRNA-Phe
  1214. Enterobacter sp. MGH 1 tRNA-Phe
  1215. Enterobacter sp. MGH 22 tRNA-Phe
  1216. Enterobacter sp. MGH 23 tRNA-Phe
  1217. Enterobacter sp. MGH 24 tRNA-Phe
  1218. Enterobacter sp. MGH 25 tRNA-Phe
  1219. Enterobacter sp. MGH 26 tRNA-Phe
  1220. Enterobacter sp. MGH 2 tRNA-Phe
  1221. Enterobacter sp. MGH 33 tRNA-Phe
  1222. Enterobacter sp. MGH 37 tRNA-Phe
  1223. Enterobacter sp. MGH 38 tRNA-Phe
  1224. Enterobacter sp. MGH 3 tRNA-Phe
  1225. Enterobacter sp. MGH 4 tRNA-Phe
  1226. Enterobacter sp. MGH 5 tRNA-Phe
  1227. Enterobacter sp. MGH 6 tRNA-Phe
  1228. Enterobacter sp. MGH 7 tRNA-Phe
  1229. Enterobacter sp. MGH85 tRNA-Phe
  1230. Enterobacter sp. MGH86 tRNA-Phe
  1231. Enterobacter sp. MGH 8 tRNA-Phe
  1232. Enterobacter sp. MGH 9 tRNA-Phe
  1233. Enterobacter hormaechei Enterobacter sp. MHSD6 tRNA-Phe
  1234. Enterobacter sp. MV-oo4-C tRNA-Phe
  1235. Enterobacter sp. MV-r1-C tRNA-Phe
  1236. Enterobacter sp. MV-x1-C tRNA-Phe
  1237. Enterobacter sp. MV-xx2-O tRNA-Phe
  1238. Enterobacter sp. MW07 tRNA-Phe
  1239. Enterobacter sp. MYb186 tRNA-Phe
  1240. Enterobacter sp. N18-03635 tRNA-Phe
  1241. Enterobacter sp. NFIX58 tRNA_Phe_GAA
  1242. Enterobacter sp. NFIX59 tRNA_Phe_GAA
  1243. Enterobacter sp. NFR05 tRNA_Phe_GAA
  1244. Enterobacter sp. NIC22-4 tRNA-Phe
  1245. Enterobacter sp. NW-057-I_ECC_S150 tRNA-Phe
  1246. Enterobacter sp. NW-057-I-ECC tRNA-Phe
  1247. Enterobacter sp. ODB01 tRNA-Phe
  1248. Enterobacter sp. OLF tRNA-Phe
  1249. Enterobacter sp. PA-016-I-ECC tRNA-Phe
  1250. Enterobacter sp. PGRG2 tRNA-Phe
  1251. Enterobacter sp. PI-10 tRNA-Phe
  1252. Enterobacter sp. PN108E5IIB tRNA-Phe
  1253. Enterobacter sp. PP-008-C-ECC tRNA-Phe
  1254. Enterobacter sp. PP-008-ECC_S150 tRNA-Phe
  1255. Enterobacter sp. PR-089-C-ECC tRNA-Phe
  1256. Enterobacter sp. PTB tRNA-Phe
  1257. Enterobacter sp. R1(2018) tRNA-Phe
  1258. Enterobacter sp. R-1.5.3 tRNA-Phe
  1259. Enterobacter sp. R-1.6.2 tRNA-Phe
  1260. Enterobacter sp. R-25 tRNA-Phe
  1261. Enterobacter sp. R4-368 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1262. Enterobacter sp. RC4 tRNA-Phe
  1263. Enterobacter sp. RCC_40 tRNA-Phe
  1264. Enterobacter sp. RD4-1-1 tRNA-Phe
  1265. Enterobacter sp. RHB15-C17 tRNA-Phe
  1266. Enterobacter sp. RHBSTW-00131 tRNA-Phe
  1267. Enterobacter sp. RHBSTW-00175 tRNA-Phe
  1268. Enterobacter sp. RHBSTW-00318 tRNA-Phe
  1269. Enterobacter sp. RHBSTW-00340 tRNA-Phe
  1270. Enterobacter sp. RHBSTW-00422 tRNA-Phe
  1271. Enterobacter sp. RHBSTW-00593 tRNA-Phe
  1272. Enterobacter sp. RHBSTW-00901 tRNA-Phe
  1273. Enterobacter sp. RHBSTW-00974 tRNA-Phe
  1274. Enterobacter sp. RHBSTW-00975 tRNA-Phe
  1275. Enterobacter sp. RHBSTW-00994 tRNA-Phe
  1276. Enterobacter sp. RHBSTW-01064 tRNA-Phe
  1277. Enterobacter sp. RIT418 tRNA-Phe
  1278. Enterobacter sp. RIT637 tRNA-Phe
  1279. Serratia sp. RJAL6 tRNA-Phe
  1280. Enterobacter sp. RVSM5a tRNA-Phe
  1281. Enterobacter sp. SA197 tRNA-Phe
  1282. Enterobacter sp. SA24 tRNA-Phe
  1283. Enterobacter sp. SAT-E-asb tRNA-Phe
  1284. Enterobacter sp. SECR18-0236 tRNA-Phe
  1285. Enterobacter sp. SECR19-1250 tRNA-Phe
  1286. Enterobacter sp. SENG-6 tRNA-Phe
  1287. Enterobacter sp. SES19 tRNA-Phe
  1288. Enterobacter sp. SGAir0187 tRNA-Phe
  1289. Enterobacter sp. SLBN-59 tRNA-Phe
  1290. Enterobacter sp. SM3 tRNA-Phe
  1291. Enterobacter sp. SORGH_AS_0287 tRNA-Phe
  1292. Enterobacter sp. SST3 tRNA-Phe
  1293. Enterobacter sp. ST121:950178628 tRNA-Phe
  1294. Enterobacter sp. T2 tRNA-Phe
  1295. Enterobacter sp. Taxon_2 tRNA-Phe
  1296. Enterobacter sp. Taxon_8 tRNA-Phe
  1297. Enterobacter sp. TCD1-1 tRNA-Phe
  1298. Enterobacter sp. TF2-1-2 tRNA-Phe
  1299. Enterobacter sp. TF5 tRNA-Phe
  1300. Enterobacter sp. TMH.L2 tRNA-Phe
  1301. Enterobacter sp. Tr-810 tRNA-Phe
  1302. Enterobacter sp. UCD-UG_FMILLET tRNA-Phe
  1303. Enterobacter sp. UNJFSC 003 tRNA-Phe
  1304. Enterobacter sp. UPMP2014 tRNA-Phe
  1305. Enterobacter sp. UPMP2015 tRNA-Phe
  1306. Enterobacter sp. UPMP2052 tRNA-Phe
  1307. Enterobacter sp. UPMP2060 tRNA-Phe
  1308. Enterobacter sp. UPMP2061 tRNA-Phe
  1309. Enterobacter sp. UPMP2076 tRNA-Phe
  1310. Enterobacter sp. UPMP701 tRNA-Phe
  1311. Enterobacter sp. V87_3 tRNA-Phe
  1312. Enterobacter sp. VA9 tRNA-Phe
  1313. Enterobacter sp. tRNA-Phe
  1314. Enterobacter sp. WCHEn045836 tRNA-Phe
  1315. Enterobacter sp. WCHEn090032 tRNA-Phe
  1316. Enterobacter wuhouensis tRNA-Phe
  1317. Enterobacter quasihormaechei tRNA-Phe
  1318. Enterobacter sp. XM tRNA-Phe
  1319. Enterobacter sp. Y17 tRNA-Phe
  1320. Enterobacter sp. yb_8 tRNA-Phe
  1321. Enterobacter sp. YSU tRNA-Phe
  1322. Enterobacter sp. Z1 tRNA-Phe
  1323. Enterobacter mori Enterobacter tabaci tRNA-Phe
  1324. Enterobacter vonholyi tRNA-Phe
  1325. Enterococcus durans tRNA-Phe
  1326. Enterococcus faecalis PF3 tRNA-Phe
  1327. Enterococcus gallinarum tRNA-Phe
  1328. Enterococcus sp. HPCN38 tRNA-Phe
  1329. Erwinia aeris tRNA-Phe
  1330. Erwinia amylovora 01SFR-BO tRNA-Phe
  1331. Erwinia amylovora ACW56400 tRNA-Phe
  1332. Erwinia amylovora ATCC 49946 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1333. Erwinia amylovora ATCC BAA-2158 tRNA-Phe
  1334. Erwinia amylovora NBRC 12687 = CFBP 1232 tRNA-Phe
  1335. Erwinia amylovora CFBP1430 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1336. Erwinia amylovora CFBP 2585 tRNA-Phe
  1337. Erwinia amylovora Ea266 tRNA-Phe
  1338. Erwinia amylovora Ea356 tRNA-Phe
  1339. Erwinia amylovora Ea644 tRNA-Phe
  1340. Erwinia amylovora LA635 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1341. Erwinia amylovora LA636 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1342. Erwinia amylovora LA637 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1343. Erwinia amylovora MR1 tRNA-Phe
  1344. Erwinia amylovora NBRC 12687 = CFBP 1232 tRNA-Phe
  1345. Erwinia amylovora tRNA-Phe
  1346. Erwinia amylovora UPN527 tRNA-Phe
  1347. Erwinia billingiae Eb661 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1348. Erwinia billingiae transfer RNA-Phe
  1349. Erwiniaceae bacterium CAU 1747 tRNA-Phe
  1350. Paramixta manurensis tRNA-Phe
  1351. Erwinia endophytica tRNA-Phe
  1352. Erwinia magellanica tRNA-Phe
  1353. Erwinia mallotivora tRNA-Phe
  1354. Erwinia papayae tRNA-Phe
  1355. Erwinia persicina (food metagenome) tRNA-Phe
  1356. Erwinia phyllosphaerae tRNA-Phe
  1357. Erwinia piriflorinigrans CFBP 5888 tRNA-Phe
  1358. Erwinia plantamica tRNA-Phe
  1359. Erwinia psidii tRNA-Phe
  1360. Erwinia psychrophila tRNA-Phe
  1361. Erwinia pyrifoliae DSM 12163 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1362. Erwinia pyrifoliae Ep1/96 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1363. Erwinia pyrifoliae tRNA-Phe
  1364. Erwinia rhapontici tRNA-Phe
  1365. Erwinia sp. 1181_3 tRNA-Phe
  1366. Erwinia sp. 198 tRNA-Phe
  1367. Erwinia sp. AK-PDG3-5 tRNA-Phe
  1368. Erwinia sp. AnSW2-5 tRNA-Phe
  1369. Erwinia sp. B116 tRNA-Phe
  1370. Erwinia sp. BNK-24-a tRNA-Phe
  1371. Erwinia sp. BNK-24-b tRNA-Phe
  1372. Erwinia sp. BNK-25 tRNA-Phe
  1373. Erwinia sp. CGal63 tRNA-Phe
  1374. Erwinia sp. D4-22 tRNA-Phe
  1375. Erwinia pyri tRNA-Phe
  1376. Erwinia artemisiae Erwinia sp. DT-104 tRNA-Phe
  1377. Erwinia sp. E602 tRNA-Phe
  1378. Erwinia sp. Eh17-17 tRNA-Phe
  1379. Erwinia sp. Ejp617 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1380. Erwinia sp. E_sp_B01_1 tRNA-Phe
  1381. Erwinia sp. E_sp_B01_3 tRNA-Phe
  1382. Erwinia sp. E_sp_B01_9 tRNA-Phe
  1383. Erwinia sp. E_sp_B04_7 tRNA-Phe
  1384. Erwinia sp. E_sp_B04_8 tRNA-Phe
  1385. Erwinia sp. E_sp_B04_9 tRNA-Phe
  1386. Erwinia sp. E_sp_W01_1 tRNA-Phe
  1387. Erwinia sp. E_sp_W01_6 tRNA-Phe
  1388. Erwinia sp. HDF1-3R tRNA-Phe
  1389. Erwinia sp. HR93 tRNA-Phe
  1390. Erwinia sorbitola tRNA-Phe
  1391. Erwinia sorbitola tRNA-Phe
  1392. Erwinia sp. JH02 tRNA-Phe
  1393. Erwinia sp. L03-1 tRNA-Phe
  1394. Erwinia sp. Leaf53 tRNA-Phe
  1395. Erwinia sp. MMLR14_017 tRNA-Phe
  1396. Erwinia sp. MYb375 tRNA-Phe
  1397. Erwinia sp. MYb416 tRNA-Phe
  1398. Erwinia sp. MYb535 tRNA-Phe
  1399. Erwinia sp. PK3-005 tRNA-Phe
  1400. Erwinia sp. PME.40.26/001 tRNA-Phe
  1401. Erwinia sp. PsM31 tRNA-Phe
  1402. Erwinia sp. QL-Z3 tRNA-Phe
  1403. Erwinia sp. STN24 tRNA-Phe
  1404. Erwinia sp. TECH1 tRNA-Phe
  1405. Erwinia sp. tRNA-Phe(gaa)
  1406. Erwinia tasmaniensis Et1/99 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1407. Erwinia tasmaniensis transfer RNA-Phe
  1408. Erwinia tracheiphila PSU-1 tRNA-Phe
  1409. Erwinia tracheiphila tRNA-Phe
  1410. Erwinia typographi tRNA-Phe
  1411. Erwinia wuhanensis tRNA-Phe
  1412. Erysipelotrichia bacterium tRNA-Phe
  1413. Escherichia albertii B156 tRNA-Phe
  1414. Escherichia albertii KF1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1415. Escherichia albertii NBRC 107761 = DSM 17582 tRNA-Phe
  1416. Escherichia albertii tRNA-Phe(gaa)
  1417. Escherichia coli 0.1288 tRNA-Phe
  1418. Escherichia coli 0.1304 tRNA-Phe
  1419. Escherichia coli 042 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1420. Escherichia coli 07798 tRNA-Phe
  1421. Escherichia coli 08BKT055439 tRNA-Phe
  1422. Escherichia coli 08BKT77219 tRNA-Phe
  1423. Escherichia coli 09BKT024447 tRNA-Phe
  1424. Escherichia coli 09BKT076207 tRNA-Phe
  1425. Escherichia coli 09BKT078844 tRNA-Phe
  1426. Escherichia coli 10.0821 tRNA-Phe
  1427. Escherichia coli 10.0833 tRNA-Phe
  1428. Escherichia coli 10.0869 tRNA-Phe
  1429. Escherichia coli 110957 tRNA-Phe
  1430. Escherichia coli 1-110-08_S1_C1 tRNA-Phe
  1431. Escherichia coli 1-110-08_S1_C2 tRNA-Phe
  1432. Escherichia coli 1-110-08_S1_C3 tRNA-Phe
  1433. Escherichia coli 1-110-08_S3_C1 tRNA-Phe
  1434. Escherichia coli 1-110-08_S3_C2 tRNA-Phe
  1435. Escherichia coli 1-110-08_S3_C3 tRNA-Phe
  1436. Escherichia coli 1-110-08_S4_C1 tRNA-Phe
  1437. Escherichia coli 1-110-08_S4_C2 tRNA-Phe
  1438. Escherichia coli 1-110-08_S4_C3 tRNA-Phe
  1439. Escherichia coli 113290 tRNA-Phe
  1440. Escherichia coli 113302 tRNA-Phe
  1441. Escherichia coli 113303 tRNA-Phe
  1442. Escherichia coli 1-176-05_S1_C1 tRNA-Phe
  1443. Escherichia coli 1-176-05_S1_C2 tRNA-Phe
  1444. Escherichia coli 1-176-05_S1_C3 tRNA-Phe
  1445. Escherichia coli 1-176-05_S3_C1 tRNA-Phe
  1446. Escherichia coli 1-176-05_S3_C2 tRNA-Phe
  1447. Escherichia coli 1-176-05_S4_C1 tRNA-Phe
  1448. Escherichia coli 1-176-05_S4_C2 tRNA-Phe
  1449. Escherichia coli 1-176-05_S4_C3 tRNA-Phe
  1450. Escherichia coli 1-182-04_S1_C1 tRNA-Phe
  1451. Escherichia coli 1-182-04_S1_C2 tRNA-Phe
  1452. Escherichia coli 1-182-04_S1_C3 tRNA-Phe
  1453. Escherichia coli 1-182-04_S3_C1 tRNA-Phe
  1454. Escherichia coli 1-182-04_S3_C2 tRNA-Phe
  1455. Escherichia coli 1-182-04_S3_C3 tRNA-Phe
  1456. Escherichia coli 1-182-04_S4_C1 tRNA-Phe
  1457. Escherichia coli 1-182-04_S4_C2 tRNA-Phe
  1458. Escherichia coli 1-182-04_S4_C3 tRNA-Phe
  1459. Escherichia coli 1.2264 tRNA-Phe
  1460. Escherichia coli 1-250-04_S1_C1 tRNA-Phe
  1461. Escherichia coli 1-250-04_S1_C2 tRNA-Phe
  1462. Escherichia coli 1-250-04_S1_C3 tRNA-Phe
  1463. Escherichia coli 1-250-04_S3_C1 tRNA-Phe
  1464. Escherichia coli 1-250-04_S3_C2 tRNA-Phe
  1465. Escherichia coli 1-250-04_S4_C1 tRNA-Phe
  1466. Escherichia coli 1-250-04_S4_C2 tRNA-Phe
  1467. Escherichia coli 1.2741 tRNA-Phe
  1468. Escherichia coli 1303 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1469. Escherichia coli 1-392-07_S1_C1 tRNA-Phe
  1470. Escherichia coli 1-392-07_S1_C2 tRNA-Phe
  1471. Escherichia coli 1-392-07_S3_C1 tRNA-Phe
  1472. Escherichia coli 1-392-07_S3_C2 tRNA-Phe
  1473. Escherichia coli 1-392-07_S3_C3 tRNA-Phe
  1474. Escherichia coli 1-392-07_S4_C1 tRNA-Phe
  1475. Escherichia coli 1-392-07_S4_C2 tRNA-Phe
  1476. Escherichia coli 1-392-07_S4_C3 tRNA-Phe
  1477. Escherichia coli 14A tRNA-Phe
  1478. Escherichia coli 151_06 tRNA-Phe
  1479. Escherichia coli 174750 tRNA-Phe
  1480. Escherichia coli 174900 tRNA-Phe
  1481. Escherichia coli 178200 tRNA-Phe
  1482. Escherichia coli 178850 tRNA-Phe
  1483. Escherichia coli 178900 tRNA-Phe
  1484. Escherichia coli 179100 tRNA-Phe
  1485. Escherichia coli 179550 tRNA-Phe
  1486. Escherichia coli 180050 tRNA-Phe
  1487. Escherichia coli 180200 tRNA-Phe
  1488. Escherichia coli 180600 tRNA-Phe
  1489. Escherichia coli 1827-70 tRNA-Phe
  1490. Escherichia coli 199900.1 tRNA-Phe
  1491. Escherichia coli 2-005-03_S1_C1 tRNA-Phe
  1492. Escherichia coli 2-005-03_S1_C2 tRNA-Phe
  1493. Escherichia coli 2-005-03_S1_C3 tRNA-Phe
  1494. Escherichia coli 2-005-03_S3_C1 tRNA-Phe
  1495. Escherichia coli 2-005-03_S3_C2 tRNA-Phe
  1496. Escherichia coli 2-005-03_S3_C3 tRNA-Phe
  1497. Escherichia coli 2-005-03_S4_C1 tRNA-Phe
  1498. Escherichia coli 2-005-03_S4_C2 tRNA-Phe
  1499. Escherichia coli 2-005-03_S4_C3 tRNA-Phe
  1500. Escherichia coli 2-011-08_S1_C1 tRNA-Phe
  1501. Escherichia coli 2-011-08_S1_C2 tRNA-Phe
  1502. Escherichia coli 2-011-08_S1_C3 tRNA-Phe
  1503. Escherichia coli 2-011-08_S3_C1 tRNA-Phe
  1504. Escherichia coli 2-011-08_S3_C2 tRNA-Phe
  1505. Escherichia coli 2-011-08_S3_C3 tRNA-Phe
  1506. Escherichia coli 2-011-08_S4_C1 tRNA-Phe
  1507. Escherichia coli 2-011-08_S4_C3 tRNA-Phe
  1508. Escherichia coli 201600.1 tRNA-Phe
  1509. Escherichia coli 2-052-05_S1_C1 tRNA-Phe
  1510. Escherichia coli 2-052-05_S1_C3 tRNA-Phe
  1511. Escherichia coli 2-052-05_S3_C1 tRNA-Phe
  1512. Escherichia coli 2-052-05_S3_C2 tRNA-Phe
  1513. Escherichia coli 2-052-05_S3_C3 tRNA-Phe
  1514. Escherichia coli 2-052-05_S4_C1 tRNA-Phe
  1515. Escherichia coli 2-052-05_S4_C2 tRNA-Phe
  1516. Escherichia coli 2-052-05_S4_C3 tRNA-Phe
  1517. Escherichia coli 2-156-04_S1_C3 tRNA-Phe
  1518. Escherichia coli 2-156-04_S3_C1 tRNA-Phe
  1519. Escherichia coli 2-156-04_S3_C2 tRNA-Phe
  1520. Escherichia coli 2-156-04_S3_C3 tRNA-Phe
  1521. Escherichia coli 2-156-04_S4_C1 tRNA-Phe
  1522. Escherichia coli 2-156-04_S4_C2 tRNA-Phe
  1523. Escherichia coli 2-156-04_S4_C3 tRNA-Phe
  1524. Escherichia coli 2-177-06_S1_C1 tRNA-Phe
  1525. Escherichia coli 2-177-06_S1_C2 tRNA-Phe
  1526. Escherichia coli 2-177-06_S1_C3 tRNA-Phe
  1527. Escherichia coli 2-177-06_S3_C1 tRNA-Phe
  1528. Escherichia coli 2-177-06_S3_C2 tRNA-Phe
  1529. Escherichia coli 2-177-06_S3_C3 tRNA-Phe
  1530. Escherichia coli 2-177-06_S4_C1 tRNA-Phe
  1531. Escherichia coli 2-177-06_S4_C2 tRNA-Phe
  1532. Escherichia coli 2-177-06_S4_C3 tRNA-Phe
  1533. Escherichia coli 2-210-07_S1_C2 tRNA-Phe
  1534. Escherichia coli 2-210-07_S1_C3 tRNA-Phe
  1535. Escherichia coli 2-210-07_S3_C1 tRNA-Phe
  1536. Escherichia coli 2-210-07_S3_C2 tRNA-Phe
  1537. Escherichia coli 2-210-07_S3_C3 tRNA-Phe
  1538. Escherichia coli 2-210-07_S4_C1 tRNA-Phe
  1539. Escherichia coli 2-210-07_S4_C2 tRNA-Phe
  1540. Escherichia coli 2-210-07_S4_C3 tRNA-Phe
  1541. Escherichia coli 2-222-05_S1_C1 tRNA-Phe
  1542. Escherichia coli 2-222-05_S1_C2 tRNA-Phe
  1543. Escherichia coli 2-222-05_S1_C3 tRNA-Phe
  1544. Escherichia coli 2-222-05_S3_C1 tRNA-Phe
  1545. Escherichia coli 2-222-05_S3_C2 tRNA-Phe
  1546. Escherichia coli 2-222-05_S3_C3 tRNA-Phe
  1547. Escherichia coli 2-222-05_S4_C1 tRNA-Phe
  1548. Escherichia coli 2-222-05_S4_C2 tRNA-Phe
  1549. Escherichia coli 2-222-05_S4_C3 tRNA-Phe
  1550. Escherichia coli 2254-75 (11a) tRNA-Phe
  1551. Escherichia coli 229_11 tRNA-Phe
  1552. Escherichia coli 2-316-03_S1_C1 tRNA-Phe
  1553. Escherichia coli 2-316-03_S1_C2 tRNA-Phe
  1554. Escherichia coli 2-316-03_S3_C1 tRNA-Phe
  1555. Escherichia coli 2-316-03_S3_C2 tRNA-Phe
  1556. Escherichia coli 2-316-03_S3_C3 tRNA-Phe
  1557. Escherichia coli 2-316-03_S4_C1 tRNA-Phe
  1558. Escherichia coli 2-316-03_S4_C2 tRNA-Phe
  1559. Escherichia coli 2-316-03_S4_C3 tRNA-Phe
  1560. Escherichia coli 2362-75 tRNA-Phe
  1561. Escherichia coli 2.3916 tRNA-Phe
  1562. Escherichia coli 2.4168 tRNA-Phe
  1563. Escherichia coli 2-427-07_S1_C1 tRNA-Phe
  1564. Escherichia coli 2-427-07_S1_C2 tRNA-Phe
  1565. Escherichia coli 2-427-07_S1_C3 tRNA-Phe
  1566. Escherichia coli 2-427-07_S3_C1 tRNA-Phe
  1567. Escherichia coli 2-427-07_S3_C3 tRNA-Phe
  1568. Escherichia coli 2-427-07_S4_C1 tRNA-Phe
  1569. Escherichia coli 2-427-07_S4_C2 tRNA-Phe
  1570. Escherichia coli 2-427-07_S4_C3 tRNA-Phe
  1571. Escherichia coli 2-460-02_S1_C1 tRNA-Phe
  1572. Escherichia coli 2-460-02_S1_C2 tRNA-Phe
  1573. Escherichia coli 2-460-02_S1_C3 tRNA-Phe
  1574. Escherichia coli 2-460-02_S3_C1 tRNA-Phe
  1575. Escherichia coli 2-460-02_S3_C2 tRNA-Phe
  1576. Escherichia coli 2-460-02_S3_C3 tRNA-Phe
  1577. Escherichia coli 2-460-02_S4_C1 tRNA-Phe
  1578. Escherichia coli 2-460-02_S4_C2 tRNA-Phe
  1579. Escherichia coli 2-460-02_S4_C3 tRNA-Phe
  1580. Escherichia coli 2-474-04_S1_C1 tRNA-Phe
  1581. Escherichia coli 2-474-04_S1_C2 tRNA-Phe
  1582. Escherichia coli 2-474-04_S3_C1 tRNA-Phe
  1583. Escherichia coli 2-474-04_S3_C2 tRNA-Phe
  1584. Escherichia coli 2-474-04_S3_C3 tRNA-Phe
  1585. Escherichia coli 2-474-04_S4_C1 tRNA-Phe
  1586. Escherichia coli 2-474-04_S4_C2 tRNA-Phe
  1587. Escherichia coli 2-474-04_S4_C3 tRNA-Phe
  1588. Escherichia coli 2534-86 tRNA-Phe
  1589. Escherichia coli 2719100 tRNA-Phe
  1590. Escherichia coli 2720900 tRNA-Phe
  1591. Escherichia coli 2722950 tRNA-Phe
  1592. Escherichia coli 2726800 tRNA-Phe
  1593. Escherichia coli 2726950 tRNA-Phe
  1594. Escherichia coli 2729250 tRNA-Phe
  1595. Escherichia coli 2730350 tRNA-Phe
  1596. Escherichia coli 2730450 tRNA-Phe
  1597. Escherichia coli 2731150 tRNA-Phe
  1598. Escherichia coli 2733950 tRNA-Phe
  1599. Escherichia coli 2735000 tRNA-Phe
  1600. Escherichia coli 2741950 tRNA-Phe
  1601. Escherichia coli 2747800 tRNA-Phe
  1602. Escherichia coli 2749250 tRNA-Phe
  1603. Escherichia coli 2756500 tRNA-Phe
  1604. Escherichia coli 2762100 tRNA-Phe
  1605. Escherichia coli 2770900 tRNA-Phe
  1606. Escherichia coli 2780750 tRNA-Phe
  1607. Escherichia coli 2785200 tRNA-Phe
  1608. Escherichia coli 2788150 tRNA-Phe
  1609. Escherichia coli 2845350 tRNA-Phe
  1610. Escherichia coli 2845650 tRNA-Phe
  1611. Escherichia coli 2846750 tRNA-Phe
  1612. Escherichia coli 2848050 tRNA-Phe
  1613. Escherichia coli 2850400 tRNA-Phe
  1614. Escherichia coli 2850750 tRNA-Phe
  1615. Escherichia coli 2851500 tRNA-Phe
  1616. Escherichia coli 2853500 tRNA-Phe
  1617. Escherichia coli 2854350 tRNA-Phe
  1618. Escherichia coli 2860050 tRNA-Phe
  1619. Escherichia coli 2860650 tRNA-Phe
  1620. Escherichia coli 2861200 tRNA-Phe
  1621. Escherichia coli 2862600 tRNA-Phe
  1622. Escherichia coli 2864350 tRNA-Phe
  1623. Escherichia coli 2865200 tRNA-Phe
  1624. Escherichia coli 2866350 tRNA-Phe
  1625. Escherichia coli 2866450 tRNA-Phe
  1626. Escherichia coli 2866550 tRNA-Phe
  1627. Escherichia coli 2866750 tRNA-Phe
  1628. Escherichia coli 2867750 tRNA-Phe
  1629. Escherichia coli 2871950 tRNA-Phe
  1630. Escherichia coli 2872000 tRNA-Phe
  1631. Escherichia coli 2872800 tRNA-Phe
  1632. Escherichia coli 2875000 tRNA-Phe
  1633. Escherichia coli 2875150 tRNA-Phe
  1634. Escherichia coli 2886-75 tRNA-Phe
  1635. Escherichia coli 290_10 tRNA-Phe
  1636. Escherichia coli 3003 tRNA-Phe
  1637. Escherichia coli 3006 tRNA-Phe
  1638. Escherichia coli 3-020-07_S1_C1 tRNA-Phe
  1639. Escherichia coli 3-020-07_S1_C2 tRNA-Phe
  1640. Escherichia coli 3-020-07_S1_C3 tRNA-Phe
  1641. Escherichia coli 3-020-07_S3_C1 tRNA-Phe
  1642. Escherichia coli 3-020-07_S3_C2 tRNA-Phe
  1643. Escherichia coli 3-020-07_S4_C1 tRNA-Phe
  1644. Escherichia coli 3-020-07_S4_C2 tRNA-Phe
  1645. Escherichia coli 3-020-07_S4_C3 tRNA-Phe
  1646. Escherichia coli 3030-1 tRNA-Phe
  1647. Escherichia coli 3-073-06_S1_C1 tRNA-Phe
  1648. Escherichia coli 3-073-06_S1_C2 tRNA-Phe
  1649. Escherichia coli 3-073-06_S3_C1 tRNA-Phe
  1650. Escherichia coli 3-073-06_S3_C2 tRNA-Phe
  1651. Escherichia coli 3-073-06_S4_C1 tRNA-Phe
  1652. Escherichia coli 3-073-06_S4_C2 tRNA-Phe
  1653. Escherichia coli 3-073-06_S4_C3 tRNA-Phe
  1654. Escherichia coli 3-105-05_S1_C1 tRNA-Phe
  1655. Escherichia coli 3-105-05_S1_C2 tRNA-Phe
  1656. Escherichia coli 3-105-05_S1_C3 tRNA-Phe
  1657. Escherichia coli 3-105-05_S3_C1 tRNA-Phe
  1658. Escherichia coli 3-105-05_S3_C2 tRNA-Phe
  1659. Escherichia coli 3-105-05_S3_C3 tRNA-Phe
  1660. Escherichia coli 3-105-05_S4_C1 tRNA-Phe
  1661. Escherichia coli 3-105-05_S4_C2 tRNA-Phe
  1662. Escherichia coli 3-105-05_S4_C3 tRNA-Phe
  1663. Escherichia coli 3.2303 tRNA-Phe
  1664. Escherichia coli 3.2608 tRNA-Phe
  1665. Escherichia coli 3-267-03_S1_C1 tRNA-Phe
  1666. Escherichia coli 3-267-03_S1_C2 tRNA-Phe
  1667. Escherichia coli 3-267-03_S1_C3 tRNA-Phe
  1668. Escherichia coli 3-267-03_S3_C1 tRNA-Phe
  1669. Escherichia coli 3-267-03_S3_C2 tRNA-Phe
  1670. Escherichia coli 3-267-03_S4_C1 tRNA-Phe
  1671. Escherichia coli 3-267-03_S4_C2 tRNA-Phe
  1672. Escherichia coli 3-373-03_S1_C1 tRNA-Phe
  1673. Escherichia coli 3-373-03_S1_C2 tRNA-Phe
  1674. Escherichia coli 3-373-03_S1_C3 tRNA-Phe
  1675. Escherichia coli 3-373-03_S3_C1 tRNA-Phe
  1676. Escherichia coli 3-373-03_S3_C2 tRNA-Phe
  1677. Escherichia coli 3-373-03_S3_C3 tRNA-Phe
  1678. Escherichia coli 3-373-03_S4_C1 tRNA-Phe
  1679. Escherichia coli 3-373-03_S4_C2 tRNA-Phe
  1680. Escherichia coli 3-373-03_S4_C3 tRNA-Phe
  1681. Escherichia coli 3.3884 tRNA-Phe
  1682. Escherichia coli 3431 tRNA-Phe
  1683. Escherichia coli 3-475-03_S1_C1 tRNA-Phe
  1684. Escherichia coli 3-475-03_S1_C2 tRNA-Phe
  1685. Escherichia coli 3-475-03_S3_C1 tRNA-Phe
  1686. Escherichia coli 3-475-03_S3_C2 tRNA-Phe
  1687. Escherichia coli 3-475-03_S4_C1 tRNA-Phe
  1688. Escherichia coli 3-475-03_S4_C2 tRNA-Phe
  1689. Escherichia coli 3.4870 tRNA-Phe
  1690. Escherichia coli 3.4880 tRNA-Phe
  1691. Escherichia coli 371_08 tRNA-Phe
  1692. Escherichia coli 4.0522 tRNA-Phe
  1693. Escherichia coli 4.0967 tRNA-Phe
  1694. Escherichia coli 4_1_47FAA tRNA-Phe
  1695. Escherichia coli 4-203-08_S1_C1 tRNA-Phe
  1696. Escherichia coli 4-203-08_S1_C2 tRNA-Phe
  1697. Escherichia coli 4-203-08_S1_C3 tRNA-Phe
  1698. Escherichia coli 4-203-08_S3_C1 tRNA-Phe
  1699. Escherichia coli 4-203-08_S3_C2 tRNA-Phe
  1700. Escherichia coli 4-203-08_S3_C3 tRNA-Phe
  1701. Escherichia coli 4-203-08_S4_C2 tRNA-Phe
  1702. Escherichia coli 4-203-08_S4_C3 tRNA-Phe
  1703. Escherichia coli 5.0588 tRNA-Phe
  1704. Escherichia coli 5.0959 tRNA-Phe
  1705. Escherichia coli 5-172-05_S1_C3 tRNA-Phe
  1706. Escherichia coli 5-172-05_S3_C1 tRNA-Phe
  1707. Escherichia coli 5-172-05_S3_C3 tRNA-Phe
  1708. Escherichia coli 5-172-05_S4_C1 tRNA-Phe
  1709. Escherichia coli 5-172-05_S4_C2 tRNA-Phe
  1710. Escherichia coli 5-172-05_S4_C3 tRNA-Phe
  1711. Escherichia coli 5.2239 tRNA-Phe
  1712. Escherichia coli 5-366-08_S1_C1 tRNA-Phe
  1713. Escherichia coli 5-366-08_S1_C3 tRNA-Phe
  1714. Escherichia coli 5-366-08_S3_C1 tRNA-Phe
  1715. Escherichia coli 5-366-08_S3_C2 tRNA-Phe
  1716. Escherichia coli 5-366-08_S3_C3 tRNA-Phe
  1717. Escherichia coli 5-366-08_S4_C1 tRNA-Phe
  1718. Escherichia coli 5-366-08_S4_C2 tRNA-Phe
  1719. Escherichia coli 536 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1720. Escherichia coli 541-15 tRNA-Phe
  1721. Escherichia coli 541-1 tRNA-Phe
  1722. Escherichia coli 5412 tRNA-Phe
  1723. Escherichia coli 55989 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1724. Escherichia coli 576-1 tRNA-Phe
  1725. Escherichia coli 5905 tRNA-Phe
  1726. Escherichia coli 6.0172 tRNA-Phe
  1727. Escherichia coli 6-175-07_S1_C1 tRNA-Phe
  1728. Escherichia coli 6-175-07_S1_C2 tRNA-Phe
  1729. Escherichia coli 6-175-07_S1_C3 tRNA-Phe
  1730. Escherichia coli 6-175-07_S3_C1 tRNA-Phe
  1731. Escherichia coli 6-175-07_S3_C2 tRNA-Phe
  1732. Escherichia coli 6-175-07_S3_C3 tRNA-Phe
  1733. Escherichia coli 6-175-07_S4_C1 tRNA-Phe
  1734. Escherichia coli 6-175-07_S4_C2 tRNA-Phe
  1735. Escherichia coli 6-175-07_S4_C3 tRNA-Phe
  1736. Escherichia coli 6-319-05_S1_C1 tRNA-Phe
  1737. Escherichia coli 6-319-05_S1_C2 tRNA-Phe
  1738. Escherichia coli 6-319-05_S1_C3 tRNA-Phe
  1739. Escherichia coli 6-319-05_S3_C1 tRNA-Phe
  1740. Escherichia coli 6-319-05_S3_C2 tRNA-Phe
  1741. Escherichia coli 6-319-05_S3_C3 tRNA-Phe
  1742. Escherichia coli 6-319-05_S4_C2 tRNA-Phe
  1743. Escherichia coli 6-319-05_S4_C3 tRNA-Phe
  1744. Escherichia coli 6-537-08_S1_C1 tRNA-Phe
  1745. Escherichia coli 6-537-08_S1_C2 tRNA-Phe
  1746. Escherichia coli 6-537-08_S1_C3 tRNA-Phe
  1747. Escherichia coli 6-537-08_S3_C1 tRNA-Phe
  1748. Escherichia coli 6-537-08_S3_C2 tRNA-Phe
  1749. Escherichia coli 6-537-08_S3_C3 tRNA-Phe
  1750. Escherichia coli 6-537-08_S4_C1 tRNA-Phe
  1751. Escherichia coli 6-537-08_S4_C2 tRNA-Phe
  1752. Escherichia coli 7.1982 tRNA-Phe
  1753. Escherichia coli 7-233-03_S1_C2 tRNA-Phe
  1754. Escherichia coli 7-233-03_S1_C3 tRNA-Phe
  1755. Escherichia coli 7-233-03_S3_C1 tRNA-Phe
  1756. Escherichia coli 7-233-03_S3_C2 tRNA-Phe
  1757. Escherichia coli 7-233-03_S3_C3 tRNA-Phe
  1758. Escherichia coli 7-233-03_S4_C1 tRNA-Phe
  1759. Escherichia coli 7-233-03_S4_C2 tRNA-Phe
  1760. Escherichia coli 7-233-03_S4_C3 tRNA-Phe
  1761. Escherichia coli 75 tRNA-Phe
  1762. Escherichia coli 8.0416 tRNA-Phe
  1763. Escherichia coli 8.0566 tRNA-Phe
  1764. Escherichia coli 8.0569 tRNA-Phe
  1765. Escherichia coli 8.0586 tRNA-Phe
  1766. Escherichia coli 8.2524 tRNA-Phe
  1767. Escherichia coli 83972 tRNA-Phe
  1768. Escherichia coli 8-415-05_S1_C1 tRNA-Phe
  1769. Escherichia coli 8-415-05_S1_C2 tRNA-Phe
  1770. Escherichia coli 8-415-05_S3_C1 tRNA-Phe
  1771. Escherichia coli 8-415-05_S3_C2 tRNA-Phe
  1772. Escherichia coli 8-415-05_S3_C3 tRNA-Phe
  1773. Escherichia coli 8-415-05_S4_C1 tRNA-Phe
  1774. Escherichia coli 8-415-05_S4_C2 tRNA-Phe
  1775. Escherichia coli 8-415-05_S4_C3 tRNA-Phe
  1776. Escherichia coli 87-1713 (10i) tRNA-Phe
  1777. Escherichia coli 88.0221 tRNA-Phe
  1778. Escherichia coli 88.1042 tRNA-Phe
  1779. Escherichia coli 88.1467 tRNA-Phe
  1780. Escherichia coli 88817 (10j) tRNA-Phe
  1781. Escherichia coli 89.0511 tRNA-Phe
  1782. Escherichia coli 90.0039 tRNA-Phe
  1783. Escherichia coli 90.0091 tRNA-Phe
  1784. Escherichia coli 900105 (10e) tRNA-Phe
  1785. Escherichia coli 9.0111 tRNA-Phe
  1786. Escherichia coli 902034 (7b) tRNA-Phe
  1787. Escherichia coli 90.2281 tRNA-Phe
  1788. Escherichia coli 907357 tRNA-Phe
  1789. Escherichia coli 907391 tRNA-Phe
  1790. Escherichia coli 907446 tRNA-Phe
  1791. Escherichia coli 907672 tRNA-Phe
  1792. Escherichia coli 907700 tRNA-Phe
  1793. Escherichia coli 907701 tRNA-Phe
  1794. Escherichia coli 907710 tRNA-Phe
  1795. Escherichia coli 907713 tRNA-Phe
  1796. Escherichia coli 907715 tRNA-Phe
  1797. Escherichia coli 907779 tRNA-Phe
  1798. Escherichia coli 907889 tRNA-Phe
  1799. Escherichia coli 907892 tRNA-Phe
  1800. Escherichia coli 908519 tRNA-Phe
  1801. Escherichia coli 908521 tRNA-Phe
  1802. Escherichia coli 908524 tRNA-Phe
  1803. Escherichia coli 908525 tRNA-Phe
  1804. Escherichia coli 908541 tRNA-Phe
  1805. Escherichia coli 908555 tRNA-Phe
  1806. Escherichia coli 908573 tRNA-Phe
  1807. Escherichia coli 908585 tRNA-Phe
  1808. Escherichia coli 908624 tRNA-Phe
  1809. Escherichia coli 908632 tRNA-Phe
  1810. Escherichia coli 908658 tRNA-Phe
  1811. Escherichia coli 908691 tRNA-Phe
  1812. Escherichia coli 909945-2 tRNA-Phe
  1813. Escherichia coli 910096-2 tRNA-Phe
  1814. Escherichia coli 9.1649 tRNA-Phe
  1815. Escherichia coli 92.0144 (F03) tRNA-Phe
  1816. Escherichia coli 93-001 tRNA-Phe
  1817. Escherichia coli 93.0055 tRNA-Phe
  1818. Escherichia coli 93.0056 tRNA-Phe
  1819. Escherichia coli 93.0624 tRNA-Phe
  1820. Escherichia coli 94.0618 tRNA-Phe
  1821. Escherichia coli 95.0083 tRNA-Phe
  1822. Escherichia coli 95.0183 tRNA-Phe
  1823. Escherichia coli 95.0943 tRNA-Phe
  1824. Escherichia coli 95.1288 tRNA-Phe
  1825. Escherichia coli 95JB1 tRNA-Phe
  1826. Escherichia coli 95NR1 tRNA-Phe
  1827. Escherichia coli 96.0107 tRNA-Phe
  1828. Escherichia coli 96.0109 tRNA-Phe
  1829. Escherichia coli 96.0427 tRNA-Phe
  1830. Escherichia coli 96.0428 tRNA-Phe
  1831. Escherichia coli 96.0497 tRNA-Phe
  1832. Escherichia coli 96.0932 tRNA-Phe
  1833. Escherichia coli 96.0939 tRNA-Phe
  1834. Escherichia coli 96.154 tRNA-Phe
  1835. Escherichia coli 97.0003 tRNA-Phe
  1836. Escherichia coli 97.0007 tRNA-Phe
  1837. Escherichia coli 97.0010 tRNA-Phe
  1838. Escherichia coli 97.0246 tRNA-Phe
  1839. Escherichia coli 97.0259 tRNA-Phe
  1840. Escherichia coli 97.0264 tRNA-Phe
  1841. Escherichia coli 97.1742 tRNA-Phe
  1842. Escherichia coli 99.0670 tRNA-Phe
  1843. Escherichia coli 99.0672 tRNA-Phe
  1844. Escherichia coli 99.0678 tRNA-Phe
  1845. Escherichia coli 99.0713 tRNA-Phe
  1846. Escherichia coli 99.0741 tRNA-Phe
  1847. Escherichia coli 99.0814 tRNA-Phe
  1848. Escherichia coli 99.0815 tRNA-Phe
  1849. Escherichia coli 99.0816 tRNA-Phe
  1850. Escherichia coli 99.1753 tRNA-Phe
  1851. Escherichia coli 99.1762 tRNA-Phe
  1852. Escherichia coli 99.1775 tRNA-Phe
  1853. Escherichia coli 99.1781 tRNA-Phe
  1854. Escherichia coli 99.1793 tRNA-Phe
  1855. Escherichia coli A35218R tRNA-Phe
  1856. Escherichia coli AA86 tRNA-Phe
  1857. Escherichia coli ABU 83972 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1858. Escherichia coli ACN001 tRNA-Phe
  1859. Escherichia coli AD30 tRNA-Phe
  1860. Escherichia coli AI27 tRNA-Phe
  1861. Escherichia coli APEC IMT5155 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1862. Escherichia coli APEC O18 tRNA-Phe
  1863. Escherichia coli APEC O1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1864. Escherichia coli APEC O2-211 tRNA-Phe
  1865. Escherichia coli APEC O2 tRNA-Phe
  1866. Escherichia coli APEC O78 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1867. Escherichia coli ARS4.2123 tRNA-Phe
  1868. Escherichia coli ATCC 25922 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1869. Escherichia coli ATCC 35150 tRNA-Phe
  1870. Escherichia coli ATCC 700728 tRNA-Phe
  1871. Escherichia coli ATCC 8739 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1872. Escherichia coli ATCC BAA-2192 tRNA-Phe
  1873. Escherichia coli ATCC BAA-2193 tRNA-Phe
  1874. Escherichia coli ATCC BAA-2196 tRNA-Phe
  1875. Escherichia coli ATCC BAA-2209 tRNA-Phe
  1876. Escherichia coli ATCC BAA-2215 tRNA-Phe
  1877. Escherichia coli ATCC BAA-2219 tRNA-Phe
  1878. Escherichia coli B088 tRNA-Phe
  1879. Escherichia coli B093 tRNA-Phe
  1880. Escherichia coli B102 tRNA-Phe
  1881. Escherichia coli B103 tRNA-Phe
  1882. Escherichia coli B104 tRNA-Phe
  1883. Escherichia coli B105 tRNA-Phe
  1884. Escherichia coli B106 tRNA-Phe
  1885. Escherichia coli B107 tRNA-Phe
  1886. Escherichia coli B108 tRNA-Phe
  1887. Escherichia coli B109 tRNA-Phe
  1888. Escherichia coli B112 tRNA-Phe
  1889. Escherichia coli B113 tRNA-Phe
  1890. Escherichia coli B114 tRNA-Phe
  1891. Escherichia coli B12:H39 tRNA-Phe
  1892. Escherichia coli B12:H4 tRNA-Phe
  1893. Escherichia coli B13:H16 tRNA-Phe
  1894. Escherichia coli B15/O112:H1 tRNA-Phe
  1895. Escherichia coli B15 tRNA-Phe
  1896. Escherichia coli B175 tRNA-Phe
  1897. Escherichia coli B17 tRNA-Phe
  1898. Escherichia coli B185 tRNA-Phe
  1899. Escherichia coli B26-1 tRNA-Phe
  1900. Escherichia coli B26-2 tRNA-Phe
  1901. Escherichia coli B28-1 tRNA-Phe
  1902. Escherichia coli B28-2 tRNA-Phe
  1903. Escherichia coli B29-1 tRNA-Phe
  1904. Escherichia coli B29-2 tRNA-Phe
  1905. Escherichia coli B2:H7 tRNA-Phe
  1906. Escherichia coli B354 tRNA-Phe
  1907. Escherichia coli B36-1 tRNA-Phe
  1908. Escherichia coli B36-2 tRNA-Phe
  1909. Escherichia coli B367 tRNA-Phe
  1910. Escherichia coli B40-1 tRNA-Phe
  1911. Escherichia coli B40-2 tRNA-Phe
  1912. Escherichia coli B41 tRNA-Phe
  1913. Escherichia coli B49-2 tRNA-Phe
  1914. Escherichia coli B5-2 tRNA-Phe
  1915. Escherichia coli B574 tRNA-Phe
  1916. Escherichia coli B671 tRNA-Phe
  1917. Escherichia coli B7-1 tRNA-Phe
  1918. Escherichia coli B7-2 tRNA-Phe
  1919. Escherichia coli B799 tRNA-Phe
  1920. Escherichia coli B7A tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1921. Escherichia coli B83 tRNA-Phe
  1922. Escherichia coli B84 tRNA-Phe
  1923. Escherichia coli B85 tRNA-Phe
  1924. Escherichia coli B86 tRNA-Phe
  1925. Escherichia coli B89 tRNA-Phe
  1926. Escherichia coli B90 tRNA-Phe
  1927. Escherichia coli B921 tRNA-Phe
  1928. Escherichia coli B93 tRNA-Phe
  1929. Escherichia coli B94 tRNA-Phe
  1930. Escherichia coli B95 tRNA-Phe
  1931. Escherichia coli B9:H18 tRNA-Phe
  1932. Escherichia coli Bal225 tRNA-Phe
  1933. Escherichia coli BCE001_MS16 tRNA-Phe
  1934. Escherichia coli BCE002_MS12 tRNA-Phe
  1935. Escherichia coli BCE006_MS-23 tRNA-Phe
  1936. Escherichia coli BCE007_MS-11 tRNA-Phe
  1937. Escherichia coli BCE008_MS-01 tRNA-Phe
  1938. Escherichia coli BCE008_MS-13 tRNA-Phe
  1939. Escherichia coli BCE011_MS-01 tRNA-Phe
  1940. Escherichia coli BCE019_MS-13 tRNA-Phe
  1941. Escherichia coli BCE030_MS-09 tRNA-Phe
  1942. Escherichia coli BCE032_MS-12 tRNA-Phe
  1943. Escherichia coli BCE034_MS-14 tRNA-Phe
  1944. Escherichia coli Bd5610_99 tRNA-Phe
  1945. Escherichia coli BIDMC 15 tRNA-Phe
  1946. Escherichia coli BIDMC 17A tRNA-Phe
  1947. Escherichia coli BIDMC 17B tRNA-Phe
  1948. Escherichia coli BIDMC 19A tRNA-Phe
  1949. Escherichia coli BIDMC 19B tRNA-Phe
  1950. Escherichia coli BIDMC 19C tRNA-Phe
  1951. Escherichia coli BIDMC 20A tRNA-Phe
  1952. Escherichia coli BIDMC 20B tRNA-Phe
  1953. Escherichia coli BIDMC 2B tRNA-Phe
  1954. Escherichia coli BIDMC 37 tRNA-Phe
  1955. Escherichia coli BIDMC 38 tRNA-Phe
  1956. Escherichia coli BIDMC 39 tRNA-Phe
  1957. Escherichia coli BIDMC 3 tRNA-Phe
  1958. Escherichia coli BIDMC 43a tRNA-Phe
  1959. Escherichia coli BIDMC 43b tRNA-Phe
  1960. Escherichia coli BIDMC 49a tRNA-Phe
  1961. Escherichia coli BIDMC 49b tRNA-Phe
  1962. Escherichia coli BIDMC 58 tRNA-Phe
  1963. Escherichia coli BIDMC 59 tRNA-Phe
  1964. Escherichia coli BIDMC 62 tRNA-Phe
  1965. Escherichia coli BIDMC 63 tRNA-Phe
  1966. Escherichia coli BIDMC 64 tRNA-Phe
  1967. Escherichia coli BIDMC 65 tRNA-Phe
  1968. Escherichia coli BIDMC 6 tRNA-Phe
  1969. Escherichia coli BIDMC 70 tRNA-Phe
  1970. Escherichia coli BIDMC 71 tRNA-Phe
  1971. Escherichia coli BIDMC 72 tRNA-Phe
  1972. Escherichia coli BIDMC 73 tRNA-Phe
  1973. Escherichia coli BIDMC 74 tRNA-Phe
  1974. Escherichia coli BIDMC 75 tRNA-Phe
  1975. Escherichia coli BIDMC 76 tRNA-Phe
  1976. Escherichia coli BIDMC 77 tRNA-Phe
  1977. Escherichia coli BIDMC 78 tRNA-Phe
  1978. Escherichia coli BIDMC 79 tRNA-Phe
  1979. Escherichia coli BIDMC 82 tRNA-Phe
  1980. Escherichia coli BIDMC 83 tRNA-Phe
  1981. Escherichia coli BIDMC 9 tRNA-Phe
  1982. Escherichia coli BL21(DE3) tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1983. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1984. Escherichia coli BL21 tRNA-Phe
  1985. Escherichia coli B str. REL606 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1986. Escherichia coli B tRNA-Phe
  1987. Escherichia coli BW25113 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  1988. Escherichia coli BW2952 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  1989. Escherichia coli BWH 24 tRNA-Phe
  1990. Escherichia coli BWH 32 tRNA-Phe
  1991. Escherichia coli BWH 34 tRNA-Phe
  1992. Escherichia coli BWH 40 tRNA-Phe
  1993. Escherichia coli C001 tRNA-Phe
  1994. Escherichia coli C186-61 (10h) tRNA-Phe
  1995. Escherichia coli C240-52 (9c) tRNA-Phe
  1996. Escherichia coli C309-64 (10g) tRNA-Phe
  1997. Escherichia coli C-34666 tRNA-Phe
  1998. Escherichia coli C691-71 (14b) tRNA-Phe
  1999. Escherichia coli CAG:4 transfer RNA-Phe(GAA)
  2000. Escherichia coli CB7326 tRNA-Phe
  2001. Escherichia coli CD249 tRNA-Phe
  2002. Escherichia coli CD311 tRNA-Phe
  2003. Escherichia coli CD340 tRNA-Phe
  2004. Escherichia coli CD400 tRNA-Phe
  2005. Escherichia coli CD436 tRNA-Phe
  2006. Escherichia coli CD466 tRNA-Phe
  2007. Escherichia coli CD467 tRNA-Phe
  2008. Escherichia coli CD471 tRNA-Phe
  2009. Escherichia coli CD505 tRNA-Phe
  2010. Escherichia coli CFT073 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2011. Escherichia coli CHS 68 tRNA-Phe
  2012. Escherichia coli CHS 69 tRNA-Phe
  2013. Escherichia coli CHS 77 tRNA-Phe
  2014. Escherichia coli C tRNA-Phe
  2015. Escherichia coli CU758 tRNA-Phe
  2016. Escherichia coli CUMT8 tRNA-Phe
  2017. Escherichia coli D10:H20 tRNA-Phe
  2018. Escherichia coli D6-113.11 transfer RNA-Phe
  2019. Escherichia coli D9 tRNA-Phe
  2020. Escherichia coli DEC10A tRNA-Phe
  2021. Escherichia coli DEC10B tRNA-Phe
  2022. Escherichia coli DEC10C tRNA-Phe
  2023. Escherichia coli DEC10D tRNA-Phe
  2024. Escherichia coli DEC10E tRNA-Phe
  2025. Escherichia coli DEC10F tRNA-Phe
  2026. Escherichia coli DEC11A tRNA-Phe
  2027. Escherichia coli DEC11B tRNA-Phe
  2028. Escherichia coli DEC11C tRNA-Phe
  2029. Escherichia coli DEC11D tRNA-Phe
  2030. Escherichia coli DEC11E tRNA-Phe
  2031. Escherichia coli DEC12A tRNA-Phe
  2032. Escherichia coli DEC12B tRNA-Phe
  2033. Escherichia coli DEC12C tRNA-Phe
  2034. Escherichia coli DEC12D tRNA-Phe
  2035. Escherichia coli DEC12E tRNA-Phe
  2036. Escherichia coli DEC13A tRNA-Phe
  2037. Escherichia coli DEC13B tRNA-Phe
  2038. Escherichia coli DEC13C tRNA-Phe
  2039. Escherichia coli DEC13D tRNA-Phe
  2040. Escherichia coli DEC13E tRNA-Phe
  2041. Escherichia coli DEC14A tRNA-Phe
  2042. Escherichia coli DEC14B tRNA-Phe
  2043. Escherichia coli DEC14C tRNA-Phe
  2044. Escherichia coli DEC14D tRNA-Phe
  2045. Escherichia coli DEC15A tRNA-Phe
  2046. Escherichia coli DEC15B tRNA-Phe
  2047. Escherichia coli DEC15C tRNA-Phe
  2048. Escherichia coli DEC15D tRNA-Phe
  2049. Escherichia coli DEC15E tRNA-Phe
  2050. Escherichia coli DEC1A tRNA-Phe
  2051. Escherichia coli DEC1B tRNA-Phe
  2052. Escherichia coli DEC1C tRNA-Phe
  2053. Escherichia coli DEC1D tRNA-Phe
  2054. Escherichia coli DEC1E tRNA-Phe
  2055. Escherichia coli DEC2A tRNA-Phe
  2056. Escherichia coli DEC2B tRNA-Phe
  2057. Escherichia coli DEC2C tRNA-Phe
  2058. Escherichia coli DEC2D tRNA-Phe
  2059. Escherichia coli DEC2E tRNA-Phe
  2060. Escherichia coli DEC3A tRNA-Phe
  2061. Escherichia coli DEC3B tRNA-Phe
  2062. Escherichia coli DEC3C tRNA-Phe
  2063. Escherichia coli DEC3D tRNA-Phe
  2064. Escherichia coli DEC3E tRNA-Phe
  2065. Escherichia coli DEC3F tRNA-Phe
  2066. Escherichia coli DEC4A tRNA-Phe
  2067. Escherichia coli DEC4B tRNA-Phe
  2068. Escherichia coli DEC4C tRNA-Phe
  2069. Escherichia coli DEC4D tRNA-Phe
  2070. Escherichia coli DEC4E tRNA-Phe
  2071. Escherichia coli DEC4F tRNA-Phe
  2072. Escherichia coli DEC5A tRNA-Phe
  2073. Escherichia coli DEC5B tRNA-Phe
  2074. Escherichia coli DEC5C tRNA-Phe
  2075. Escherichia coli DEC5D tRNA-Phe
  2076. Escherichia coli DEC5E tRNA-Phe
  2077. Escherichia coli DEC6A tRNA-Phe
  2078. Escherichia coli DEC6B tRNA-Phe
  2079. Escherichia coli DEC6C tRNA-Phe
  2080. Escherichia coli DEC6D tRNA-Phe
  2081. Escherichia coli DEC6E tRNA-Phe
  2082. Escherichia coli DEC7A tRNA-Phe
  2083. Escherichia coli DEC7B tRNA-Phe
  2084. Escherichia coli DEC7C tRNA-Phe
  2085. Escherichia coli DEC7D tRNA-Phe
  2086. Escherichia coli DEC7E tRNA-Phe
  2087. Escherichia coli DEC8A tRNA-Phe
  2088. Escherichia coli DEC8B tRNA-Phe
  2089. Escherichia coli DEC8C tRNA-Phe
  2090. Escherichia coli DEC8D tRNA-Phe
  2091. Escherichia coli DEC8E tRNA-Phe
  2092. Escherichia coli DEC9A tRNA-Phe
  2093. Escherichia coli DEC9B tRNA-Phe
  2094. Escherichia coli DEC9C tRNA-Phe
  2095. Escherichia coli DEC9D tRNA-Phe
  2096. Escherichia coli DEC9E tRNA-Phe
  2097. Escherichia coli DH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2098. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Phe
  2099. Escherichia coli E1002 tRNA-Phe
  2100. Escherichia coli E101 tRNA-Phe
  2101. Escherichia coli E1114 tRNA-Phe
  2102. Escherichia coli E1118 tRNA-Phe
  2103. Escherichia coli E1140 tRNA-Phe
  2104. Escherichia coli E1167 tRNA-Phe
  2105. Escherichia coli E128010 tRNA-Phe
  2106. Escherichia coli E1520 tRNA-Phe
  2107. Escherichia coli E1728 tRNA-Phe
  2108. Escherichia coli E267 tRNA-Phe
  2109. Escherichia coli E482 tRNA-Phe
  2110. Escherichia coli E560 tRNA-Phe
  2111. Escherichia coli E704 tRNA-Phe
  2112. Escherichia coli EC096/10 tRNA-Phe
  2113. Escherichia coli EC1734 tRNA-Phe
  2114. Escherichia coli EC1735 tRNA-Phe
  2115. Escherichia coli EC1736 tRNA-Phe
  2116. Escherichia coli EC1737 tRNA-Phe
  2117. Escherichia coli EC1738 tRNA-Phe
  2118. Escherichia coli EC1845 tRNA-Phe
  2119. Escherichia coli EC1846 tRNA-Phe
  2120. Escherichia coli EC1848 tRNA-Phe
  2121. Escherichia coli EC1849 tRNA-Phe
  2122. Escherichia coli EC1850 tRNA-Phe
  2123. Escherichia coli EC1856 tRNA-Phe
  2124. Escherichia coli EC1862 tRNA-Phe
  2125. Escherichia coli EC1863 tRNA-Phe
  2126. Escherichia coli EC1864 tRNA-Phe
  2127. Escherichia coli EC1865 tRNA-Phe
  2128. Escherichia coli EC1866 tRNA-Phe
  2129. Escherichia coli EC1868 tRNA-Phe
  2130. Escherichia coli EC1869 tRNA-Phe
  2131. Escherichia coli EC1870 tRNA-Phe
  2132. Escherichia coli EC4013 tRNA-Phe
  2133. Escherichia coli EC4196 tRNA-Phe
  2134. Escherichia coli EC4203 tRNA-Phe
  2135. Escherichia coli EC4402 tRNA-Phe
  2136. Escherichia coli EC4421 tRNA-Phe
  2137. Escherichia coli EC4422 tRNA-Phe
  2138. Escherichia coli EC4436 tRNA-Phe
  2139. Escherichia coli EC4437 tRNA-Phe
  2140. Escherichia coli EC4439 tRNA-Phe
  2141. Escherichia coli EC4448 tRNA-Phe
  2142. Escherichia coli EC96038 tRNA-Phe
  2143. Escherichia coli ECA-0157 tRNA-Phe
  2144. Escherichia coli ECA-727 tRNA-Phe
  2145. Escherichia coli ECC-1470 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2146. Escherichia coli ECC-Z tRNA-Phe
  2147. Escherichia coli ED1a tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2148. Escherichia coli Envira 10/1 tRNA-Phe
  2149. Escherichia coli Envira 8/11 tRNA-Phe
  2150. Escherichia coli EPECa12 tRNA-Phe
  2151. Escherichia coli EPECa14 tRNA-Phe
  2152. Escherichia coli EPEC C342-62 tRNA-Phe
  2153. Escherichia coli ER2796 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2154. Escherichia coli ETEC H10407 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2155. Escherichia coli FAP1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2156. Escherichia coli FDA504 tRNA-Phe
  2157. Escherichia coli FDA505 tRNA-Phe
  2158. Escherichia coli FDA506 tRNA-Phe
  2159. Escherichia coli FDA507 tRNA-Phe
  2160. Escherichia coli FDA517 tRNA-Phe
  2161. Escherichia coli FRIK1985 tRNA-Phe
  2162. Escherichia coli FRIK1990 tRNA-Phe
  2163. Escherichia coli FRIK1996 tRNA-Phe
  2164. Escherichia coli FRIK1997 tRNA-Phe
  2165. Escherichia coli FRIK1999 tRNA-Phe
  2166. Escherichia coli FRIK2001 tRNA-Phe
  2167. Escherichia coli FRIK523 tRNA-Phe
  2168. Escherichia coli FRIK920 tRNA-Phe
  2169. Escherichia coli FVEC1302 tRNA-Phe
  2170. Escherichia coli FVEC1412 tRNA-Phe
  2171. Escherichia coli FVEC1465 tRNA-Phe
  2172. Escherichia coli G132 tRNA-Phe
  2173. Escherichia coli G150 tRNA-Phe
  2174. Escherichia coli G199 tRNA-Phe
  2175. Escherichia coli G216 tRNA-Phe
  2176. Escherichia coli G3/10 tRNA-Phe
  2177. Escherichia coli G58-1 tRNA-Phe
  2178. Escherichia coli H001 tRNA-Phe
  2179. Escherichia coli H003 tRNA-Phe
  2180. Escherichia coli H006 tRNA-Phe
  2181. Escherichia coli H016 tRNA-Phe
  2182. Escherichia coli H061 tRNA-Phe
  2183. Escherichia coli :H10 tRNA-Phe
  2184. Escherichia coli H10 tRNA-Phe
  2185. Escherichia coli H11 tRNA-Phe
  2186. Escherichia coli H120 tRNA-Phe
  2187. Escherichia coli H12 tRNA-Phe
  2188. Escherichia coli :H14 tRNA-Phe
  2189. Escherichia coli H14 tRNA-Phe
  2190. Escherichia coli :H15 tRNA-Phe
  2191. Escherichia coli :H16 tRNA-Phe
  2192. Escherichia coli H17 tRNA-Phe
  2193. Escherichia coli H18 tRNA-Phe
  2194. Escherichia coli :H19 tRNA-Phe
  2195. Escherichia coli H19 tRNA-Phe
  2196. Escherichia coli H1 tRNA-Phe
  2197. Escherichia coli H20 tRNA-Phe
  2198. Escherichia coli :H21 tRNA-Phe
  2199. Escherichia coli H21 tRNA-Phe
  2200. Escherichia coli H223 tRNA-Phe
  2201. Escherichia coli H23 tRNA-Phe
  2202. Escherichia coli H252 tRNA-Phe
  2203. Escherichia coli :H25 tRNA-Phe
  2204. Escherichia coli H263 tRNA-Phe
  2205. Escherichia coli H26 tRNA-Phe
  2206. Escherichia coli H27 tRNA-Phe
  2207. Escherichia coli H28 tRNA-Phe
  2208. Escherichia coli H296 tRNA-Phe
  2209. Escherichia coli H299 tRNA-Phe
  2210. Escherichia coli :H2 tRNA-Phe
  2211. Escherichia coli H305 tRNA-Phe
  2212. Escherichia coli H30 tRNA-Phe
  2213. Escherichia coli H32 tRNA-Phe
  2214. Escherichia coli H34 tRNA-Phe
  2215. Escherichia coli H378 tRNA-Phe
  2216. Escherichia coli H37 tRNA-Phe
  2217. Escherichia coli H383 tRNA-Phe
  2218. Escherichia coli H386 tRNA-Phe
  2219. Escherichia coli H397 tRNA-Phe
  2220. Escherichia coli H40 tRNA-Phe
  2221. Escherichia coli H413 tRNA-Phe
  2222. Escherichia coli H420 tRNA-Phe
  2223. Escherichia coli H454 tRNA-Phe
  2224. Escherichia coli :H45 tRNA-Phe
  2225. Escherichia coli H45 tRNA-Phe
  2226. Escherichia coli H461 tRNA-Phe
  2227. Escherichia coli H46 tRNA-Phe
  2228. Escherichia coli H489 tRNA-Phe
  2229. Escherichia coli :H48 tRNA-Phe
  2230. Escherichia coli H48 tRNA-Phe
  2231. Escherichia coli H494 tRNA-Phe
  2232. Escherichia coli :H49 tRNA-Phe
  2233. Escherichia coli :H4 tRNA-Phe
  2234. Escherichia coli H4 tRNA-Phe
  2235. Escherichia coli H51 tRNA-Phe
  2236. Escherichia coli H588 tRNA-Phe
  2237. Escherichia coli H591 tRNA-Phe
  2238. Escherichia coli :H5 tRNA-Phe
  2239. Escherichia coli H5 tRNA-Phe
  2240. Escherichia coli H605 tRNA-Phe
  2241. Escherichia coli H617 tRNA-Phe
  2242. Escherichia coli H6 tRNA-Phe
  2243. Escherichia coli H730 tRNA-Phe
  2244. Escherichia coli H736 tRNA-Phe
  2245. Escherichia coli :H7 tRNA-Phe
  2246. Escherichia coli H7 tRNA-Phe
  2247. Escherichia coli H8 tRNA-Phe
  2248. Escherichia coli H9 tRNA-Phe
  2249. Escherichia coli HB101 tRNA-Phe
  2250. Escherichia coli HM605 tRNA-Phe
  2251. Escherichia coli HS tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2252. Escherichia coli HT115 tRNA-Phe
  2253. Escherichia coli HVH 100 (4-2850729) tRNA-Phe
  2254. Escherichia coli HVH 101 (4-6859844) tRNA-Phe
  2255. Escherichia coli HVH 102 (4-6906788) tRNA-Phe
  2256. Escherichia coli HVH 103 (4-5904188) tRNA-Phe
  2257. Escherichia coli HVH 104 (4-6977960) tRNA-Phe
  2258. Escherichia coli HVH 10 (4-6832164) (4-6832164) tRNA-Phe
  2259. Escherichia coli HVH 106 (4-6881831) tRNA-Phe
  2260. Escherichia coli HVH 107 (4-5860571) tRNA-Phe
  2261. Escherichia coli HVH 108 (4-6924867) tRNA-Phe
  2262. Escherichia coli HVH 109 (4-6977162) tRNA-Phe
  2263. Escherichia coli HVH 110 (4-6978754) tRNA-Phe
  2264. Escherichia coli HVH 111 (4-7039018) tRNA-Phe
  2265. Escherichia coli HVH 112 (4-5987253) tRNA-Phe
  2266. Escherichia coli HVH 113 (4-7535473) tRNA-Phe
  2267. Escherichia coli HVH 114 (4-7037740) tRNA-Phe
  2268. Escherichia coli HVH 115 (4-4465989) tRNA-Phe
  2269. Escherichia coli HVH 115 (4-4465997) tRNA-Phe
  2270. Escherichia coli HVH 116 (4-6879942) tRNA-Phe
  2271. Escherichia coli HVH 117 (4-6857191) tRNA-Phe
  2272. Escherichia coli HVH 118 (4-7345399) tRNA-Phe
  2273. Escherichia coli HVH 119 (4-6879578) tRNA-Phe
  2274. Escherichia coli HVH 120 (4-6978681) tRNA-Phe
  2275. Escherichia coli HVH 121 (4-6877826) tRNA-Phe
  2276. Escherichia coli HVH 122 (4-6851606) tRNA-Phe
  2277. Escherichia coli HVH 12 (4-7653042) tRNA-Phe
  2278. Escherichia coli HVH 125 (4-2634716) tRNA-Phe
  2279. Escherichia coli HVH 126 (4-6034225) tRNA-Phe
  2280. Escherichia coli HVH 127 (4-7303629) tRNA-Phe
  2281. Escherichia coli HVH 128 (4-7030436) tRNA-Phe
  2282. Escherichia coli HVH 130 (4-7036876) tRNA-Phe
  2283. Escherichia coli HVH 132 (4-6876862) tRNA-Phe
  2284. Escherichia coli HVH 133 (4-4466519) tRNA-Phe
  2285. Escherichia coli HVH 134 (4-6073441) tRNA-Phe
  2286. Escherichia coli HVH 13 (4-7634056) tRNA-Phe
  2287. Escherichia coli HVH 135 (4-4449320) tRNA-Phe
  2288. Escherichia coli HVH 136 (4-5970458) tRNA-Phe
  2289. Escherichia coli HVH 137 (4-2124971) tRNA-Phe
  2290. Escherichia coli HVH 138 (4-6066704) tRNA-Phe
  2291. Escherichia coli HVH 139 (4-3192644) (4-3192644) tRNA-Phe
  2292. Escherichia coli HVH 140 (4-5894387) tRNA-Phe
  2293. Escherichia coli HVH 141 (4-5995973) tRNA-Phe
  2294. Escherichia coli HVH 142 (4-5627451) tRNA-Phe
  2295. Escherichia coli HVH 143 (4-5674999) tRNA-Phe
  2296. Escherichia coli HVH 144 (4-4451937) tRNA-Phe
  2297. Escherichia coli HVH 145 (4-5672112) tRNA-Phe
  2298. Escherichia coli HVH 146 (4-3189767) tRNA-Phe
  2299. Escherichia coli HVH 1 (4-6876161) tRNA-Phe
  2300. Escherichia coli HVH 147 (4-5893887) tRNA-Phe
  2301. Escherichia coli HVH 148 (4-3192490) tRNA-Phe
  2302. Escherichia coli HVH 149 (4-4451880) (4-4451880) tRNA-Phe
  2303. Escherichia coli HVH 150 (4-3258106) tRNA-Phe
  2304. Escherichia coli HVH 151 (4-5755573) tRNA-Phe
  2305. Escherichia coli HVH 152 (4-3447545) (4-3447545) tRNA-Phe
  2306. Escherichia coli HVH 153 (3-9344314) tRNA-Phe
  2307. Escherichia coli HVH 154 (4-5636698) tRNA-Phe
  2308. Escherichia coli HVH 155 (4-4509048) tRNA-Phe
  2309. Escherichia coli HVH 156 (4-3206505) tRNA-Phe
  2310. Escherichia coli HVH 157 (4-3406229) tRNA-Phe
  2311. Escherichia coli HVH 158 (4-3224287) tRNA-Phe
  2312. Escherichia coli HVH 159 (4-5818141) tRNA-Phe
  2313. Escherichia coli HVH 160 (4-5695937) (4-5695937) tRNA-Phe
  2314. Escherichia coli HVH 161 (4-3119890) tRNA-Phe
  2315. Escherichia coli HVH 162 (4-5627982) tRNA-Phe
  2316. Escherichia coli HVH 163 (4-4697553) tRNA-Phe
  2317. Escherichia coli HVH 164 (4-5953081) tRNA-Phe
  2318. Escherichia coli HVH 16 (4-7649002) tRNA-Phe
  2319. Escherichia coli HVH 167 (4-6073565) (4-6073565) tRNA-Phe
  2320. Escherichia coli HVH 169 (4-1075578) tRNA-Phe
  2321. Escherichia coli HVH 170 (4-3026949) tRNA-Phe
  2322. Escherichia coli HVH 171 (4-3191958) tRNA-Phe
  2323. Escherichia coli HVH 172 (4-3248542) tRNA-Phe
  2324. Escherichia coli HVH 173 (3-9175482) (3-9175482) tRNA-Phe
  2325. Escherichia coli HVH 17 (4-7473087) tRNA-Phe
  2326. Escherichia coli HVH 175 (4-3405184) tRNA-Phe
  2327. Escherichia coli HVH 176 (4-3428664) tRNA-Phe
  2328. Escherichia coli HVH 177 (4-2876612) (4-2876612) tRNA-Phe
  2329. Escherichia coli HVH 178 (4-3189163) tRNA-Phe
  2330. Escherichia coli HVH 180 (4-3051617) tRNA-Phe
  2331. Escherichia coli HVH 182 (4-0985554) tRNA-Phe
  2332. Escherichia coli HVH 183 (4-3205932) tRNA-Phe
  2333. Escherichia coli HVH 184 (4-3343286) (4-3343286) tRNA-Phe
  2334. Escherichia coli HVH 18 (4-8589585) tRNA-Phe
  2335. Escherichia coli HVH 185 (4-2876639) tRNA-Phe
  2336. Escherichia coli HVH 186 (4-3405044) tRNA-Phe
  2337. Escherichia coli HVH 187 (4-4471660) tRNA-Phe
  2338. Escherichia coli HVH 188 (4-2356988) tRNA-Phe
  2339. Escherichia coli HVH 189 (4-3220125) tRNA-Phe
  2340. Escherichia coli HVH 190 (4-3255514) tRNA-Phe
  2341. Escherichia coli HVH 191 (3-9341900) tRNA-Phe
  2342. Escherichia coli HVH 192 (4-3054470) tRNA-Phe
  2343. Escherichia coli HVH 193 (4-3331423) tRNA-Phe
  2344. Escherichia coli HVH 194 (4-2356805) tRNA-Phe
  2345. Escherichia coli HVH 19 (4-7154984) tRNA-Phe
  2346. Escherichia coli HVH 195 (3-7155360) tRNA-Phe
  2347. Escherichia coli HVH 196 (4-4530470) tRNA-Phe
  2348. Escherichia coli HVH 197 (4-4466217) tRNA-Phe
  2349. Escherichia coli HVH 198 (4-3206106) tRNA-Phe
  2350. Escherichia coli HVH 199 (4-5670322) (4-5670322) tRNA-Phe
  2351. Escherichia coli HVH 200 (4-4449924) (4-4449924) tRNA-Phe
  2352. Escherichia coli HVH 201 (4-4459431) tRNA-Phe
  2353. Escherichia coli HVH 202 (4-3163997) tRNA-Phe
  2354. Escherichia coli HVH 203 (4-3126218) tRNA-Phe
  2355. Escherichia coli HVH 204 (4-3112802) tRNA-Phe
  2356. Escherichia coli HVH 20 (4-5865042) (4-5865042) tRNA-Phe
  2357. Escherichia coli HVH 205 (4-3094677) tRNA-Phe
  2358. Escherichia coli HVH 206 (4-3128229) tRNA-Phe
  2359. Escherichia coli HVH 207 (4-3113221) tRNA-Phe
  2360. Escherichia coli HVH 208 (4-3112292) tRNA-Phe
  2361. Escherichia coli HVH 209 (4-3062651) tRNA-Phe
  2362. Escherichia coli HVH 210 (4-3042480) tRNA-Phe
  2363. Escherichia coli HVH 211 (4-3041891) tRNA-Phe
  2364. Escherichia coli HVH 212 (3-9305343) tRNA-Phe
  2365. Escherichia coli HVH 213 (4-3042928) tRNA-Phe
  2366. Escherichia coli HVH 214 (4-3062198) tRNA-Phe
  2367. Escherichia coli HVH 21 (4-4517873) tRNA-Phe
  2368. Escherichia coli HVH 215 (4-3008371) (4-3008371) tRNA-Phe
  2369. Escherichia coli HVH 216 (4-3042952) tRNA-Phe
  2370. Escherichia coli HVH 217 (4-1022806) (4-1022806) tRNA-Phe
  2371. Escherichia coli HVH 218 (4-4500903) tRNA-Phe
  2372. Escherichia coli HVH 220 (4-5876842) tRNA-Phe
  2373. Escherichia coli HVH 221 (4-3136817) tRNA-Phe
  2374. Escherichia coli HVH 222 (4-2977443) (4-2977443) tRNA-Phe
  2375. Escherichia coli HVH 223 (4-2976528) (4-2976528) tRNA-Phe
  2376. Escherichia coli HVH 22 (4-2258986) tRNA-Phe
  2377. Escherichia coli HVH 225 (4-1273116) tRNA-Phe
  2378. Escherichia coli HVH 227 (4-2277670) tRNA-Phe
  2379. Escherichia coli HVH 228 (4-7787030) tRNA-Phe
  2380. Escherichia coli HVH 23 (4-6066488) tRNA-Phe
  2381. Escherichia coli HVH 24 (4-5985145) tRNA-Phe
  2382. Escherichia coli HVH 2 (4-6943160) tRNA-Phe
  2383. Escherichia coli HVH 25 (4-5851939) (4-5851939) tRNA-Phe
  2384. Escherichia coli HVH 26 (4-5703913) (4-5703913) tRNA-Phe
  2385. Escherichia coli HVH 27 (4-7449267) tRNA-Phe
  2386. Escherichia coli HVH 28 (4-0907367) tRNA-Phe
  2387. Escherichia coli HVH 29 (4-3418073) tRNA-Phe
  2388. Escherichia coli HVH 30 (4-2661829) tRNA-Phe
  2389. Escherichia coli HVH 31 (4-2602156) tRNA-Phe
  2390. Escherichia coli HVH 32 (4-3773988) tRNA-Phe
  2391. Escherichia coli HVH 33 (4-2174936) tRNA-Phe
  2392. Escherichia coli HVH 3 (4-7276001) (4-7276001) tRNA-Phe
  2393. Escherichia coli HVH 35 (4-2962667) (4-2962667) tRNA-Phe
  2394. Escherichia coli HVH 36 (4-5675286) tRNA-Phe
  2395. Escherichia coli HVH 37 (4-2773848) tRNA-Phe
  2396. Escherichia coli HVH 38 (4-2774682) (4-2774682) tRNA-Phe
  2397. Escherichia coli HVH 39 (4-2679949) (4-2679949) tRNA-Phe
  2398. Escherichia coli HVH 40 (4-1219782) (4-1219782) tRNA-Phe
  2399. Escherichia coli HVH 41 (4-2677849) tRNA-Phe
  2400. Escherichia coli HVH 42 (4-2100061) (4-2100061) tRNA-Phe
  2401. Escherichia coli HVH 43 (4-2173468) tRNA-Phe
  2402. Escherichia coli HVH 44 (4-2298570) tRNA-Phe
  2403. Escherichia coli HVH 4 (4-7276109) tRNA-Phe
  2404. Escherichia coli HVH 45 (4-3129918) tRNA-Phe
  2405. Escherichia coli HVH 46 (4-2758776) tRNA-Phe
  2406. Escherichia coli HVH 48 (4-2658593) (4-2658593) tRNA-Phe
  2407. Escherichia coli HVH 50 (4-2593475) tRNA-Phe
  2408. Escherichia coli HVH 51 (4-2172526) tRNA-Phe
  2409. Escherichia coli HVH 53 (4-0631051) (4-0631051) tRNA-Phe
  2410. Escherichia coli HVH 54 (4-2723514) tRNA-Phe
  2411. Escherichia coli HVH 5 (4-7148410) tRNA-Phe
  2412. Escherichia coli HVH 55 (4-2646161) tRNA-Phe
  2413. Escherichia coli HVH 56 (4-2153033) tRNA-Phe
  2414. Escherichia coli HVH 58 (4-2839709) (4-2839709) tRNA-Phe
  2415. Escherichia coli HVH 59 (4-1119338) tRNA-Phe
  2416. Escherichia coli HVH 61 (4-2736020) tRNA-Phe
  2417. Escherichia coli HVH 63 (4-2542528) (4-2542528) tRNA-Phe
  2418. Escherichia coli HVH 6 (3-8296502) tRNA-Phe
  2419. Escherichia coli HVH 65 (4-2262045) tRNA-Phe
  2420. Escherichia coli HVH 68 (4-0888028) tRNA-Phe
  2421. Escherichia coli HVH 69 (4-2837072) tRNA-Phe
  2422. Escherichia coli HVH 70 (4-2963531) tRNA-Phe
  2423. Escherichia coli HVH 73 (4-2393174) tRNA-Phe
  2424. Escherichia coli HVH 74 (4-1034782) tRNA-Phe
  2425. Escherichia coli HVH 7 (4-7315031) tRNA-Phe
  2426. Escherichia coli HVH 76 (4-2538717) tRNA-Phe
  2427. Escherichia coli HVH 77 (4-2605759) tRNA-Phe
  2428. Escherichia coli HVH 78 (4-2735946) tRNA-Phe
  2429. Escherichia coli HVH 79 (4-2512823) tRNA-Phe
  2430. Escherichia coli HVH 80 (4-2428830) tRNA-Phe
  2431. Escherichia coli HVH 82 (4-2209276) (4-2209276) tRNA-Phe
  2432. Escherichia coli HVH 83 (4-2051087) tRNA-Phe
  2433. Escherichia coli HVH 84 (4-1021478) tRNA-Phe
  2434. Escherichia coli HVH 85 (4-0792144) tRNA-Phe
  2435. Escherichia coli HVH 86 (4-7026218) tRNA-Phe
  2436. Escherichia coli HVH 87 (4-5977630) tRNA-Phe
  2437. Escherichia coli HVH 88 (4-5854636) tRNA-Phe
  2438. Escherichia coli HVH 89 (4-5885604) (4-5885604) tRNA-Phe
  2439. Escherichia coli HVH 90 (4-3191362) tRNA-Phe
  2440. Escherichia coli HVH 91 (4-4638751) tRNA-Phe
  2441. Escherichia coli HVH 92 (4-5930790) tRNA-Phe
  2442. Escherichia coli HVH 93 (4-5851025) tRNA-Phe
  2443. Escherichia coli HVH 9 (4-6942539) (4-6942539) tRNA-Phe
  2444. Escherichia coli HVH 95 (4-6074464) tRNA-Phe
  2445. Escherichia coli HVH 96 (4-5934869) tRNA-Phe
  2446. Escherichia coli HVH 98 (4-5799287) tRNA-Phe
  2447. Escherichia coli IAI1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2448. Escherichia coli IAI39 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2449. Escherichia coli IHE3034 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2450. Escherichia coli J53 tRNA-Phe
  2451. Escherichia coli J96 tRNA-Phe
  2452. Escherichia coli JB1-95 tRNA-Phe
  2453. Escherichia coli JJ1886 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2454. Escherichia coli JJ1887 tRNA-Phe
  2455. Escherichia coli JJ1897 tRNA-Phe
  2456. Escherichia coli JJ1901 tRNA-Phe
  2457. Escherichia coli JJ1908 tRNA-Phe
  2458. Escherichia coli JJ1996 tRNA-Phe
  2459. Escherichia coli JJ1999 tRNA-Phe
  2460. Escherichia coli JJ2016 tRNA-Phe
  2461. Escherichia coli JJ2038 tRNA-Phe
  2462. Escherichia coli JJ2050 tRNA-Phe
  2463. Escherichia coli JJ2055 tRNA-Phe
  2464. Escherichia coli JJ2087 tRNA-Phe
  2465. Escherichia coli JJ2118 tRNA-Phe
  2466. Escherichia coli JJ2134 tRNA-Phe
  2467. Escherichia coli JJ2183 tRNA-Phe
  2468. Escherichia coli JJ2193 tRNA-Phe
  2469. Escherichia coli JJ2444 tRNA-Phe
  2470. Escherichia coli JJ2508 tRNA-Phe
  2471. Escherichia coli JJ2528 tRNA-Phe
  2472. Escherichia coli JJ2547 tRNA-Phe
  2473. Escherichia coli JJ2550 tRNA-Phe
  2474. Escherichia coli JJ2555 tRNA-Phe
  2475. Escherichia coli JJ2578 tRNA-Phe
  2476. Escherichia coli JJ2591 tRNA-Phe
  2477. Escherichia coli JJ2608 tRNA-Phe
  2478. Escherichia coli JJ2643 tRNA-Phe
  2479. Escherichia coli JJ2657 tRNA-Phe
  2480. Escherichia coli JJ2668 tRNA-Phe
  2481. Escherichia coli JMI025 tRNA-Phe
  2482. Escherichia coli JMI268 tRNA-Phe
  2483. Escherichia coli Jurua 18/11 tRNA-Phe
  2484. Escherichia coli Jurua 20/10 tRNA-Phe
  2485. Escherichia coli K02 tRNA-Phe
  2486. Escherichia coli K-12 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2487. Escherichia coli K71 tRNA-Phe
  2488. Escherichia coli KD1 tRNA-Phe
  2489. Escherichia coli KLY tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2490. Escherichia coli KN1604 tRNA-Phe
  2491. Escherichia coli KO11FL tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2492. Escherichia coli KOEGE 10 (25a) tRNA-Phe
  2493. Escherichia coli KOEGE 118 (317a) (317a) tRNA-Phe
  2494. Escherichia coli KOEGE 131 (358a) tRNA-Phe
  2495. Escherichia coli KOEGE 30 (63a) tRNA-Phe
  2496. Escherichia coli KOEGE 32 (66a) tRNA-Phe
  2497. Escherichia coli KOEGE 33 (68a) tRNA-Phe
  2498. Escherichia coli KOEGE 3 (4a) (4a) tRNA-Phe
  2499. Escherichia coli KOEGE 40 (102a) tRNA-Phe
  2500. Escherichia coli KOEGE 43 (105a) (105a) tRNA-Phe
  2501. Escherichia coli KOEGE 44 (106a) (106a) tRNA-Phe
  2502. Escherichia coli KOEGE 56 (169a) (169a) tRNA-Phe
  2503. Escherichia coli KOEGE 58 (171a) tRNA-Phe
  2504. Escherichia coli KOEGE 61 (174a) tRNA-Phe
  2505. Escherichia coli KOEGE 62 (175a) (175a) tRNA-Phe
  2506. Escherichia coli KOEGE 68 (182a) tRNA-Phe
  2507. Escherichia coli KOEGE 70 (185a) tRNA-Phe
  2508. Escherichia coli KOEGE 71 (186a) tRNA-Phe
  2509. Escherichia coli KOEGE 7 (16a) tRNA-Phe
  2510. Escherichia coli KOEGE 73 (195a) tRNA-Phe
  2511. Escherichia coli KOEGE 77 (202a) tRNA-Phe
  2512. Escherichia coli KTE100 tRNA-Phe
  2513. Escherichia coli KTE101 tRNA-Phe
  2514. Escherichia coli KTE102 tRNA-Phe
  2515. Escherichia coli KTE103 tRNA-Phe
  2516. Escherichia coli KTE104 tRNA-Phe
  2517. Escherichia coli KTE105 tRNA-Phe
  2518. Escherichia coli KTE106 tRNA-Phe
  2519. Escherichia coli KTE107 tRNA-Phe
  2520. Escherichia coli KTE108 tRNA-Phe
  2521. Escherichia coli KTE109 tRNA-Phe
  2522. Escherichia coli KTE10 tRNA-Phe
  2523. Escherichia coli KTE110 tRNA-Phe
  2524. Escherichia coli KTE111 tRNA-Phe
  2525. Escherichia coli KTE112 tRNA-Phe
  2526. Escherichia coli KTE113 tRNA-Phe
  2527. Escherichia coli KTE115 tRNA-Phe
  2528. Escherichia coli KTE116 tRNA-Phe
  2529. Escherichia coli KTE117 tRNA-Phe
  2530. Escherichia coli KTE118 tRNA-Phe
  2531. Escherichia coli KTE119 tRNA-Phe
  2532. Escherichia coli KTE120 tRNA-Phe
  2533. Escherichia coli KTE121 tRNA-Phe
  2534. Escherichia coli KTE122 tRNA-Phe
  2535. Escherichia coli KTE123 tRNA-Phe
  2536. Escherichia coli KTE124 tRNA-Phe
  2537. Escherichia coli KTE125 tRNA-Phe
  2538. Escherichia coli KTE126 tRNA-Phe
  2539. Escherichia coli KTE127 tRNA-Phe
  2540. Escherichia coli KTE128 tRNA-Phe
  2541. Escherichia coli KTE129 tRNA-Phe
  2542. Escherichia coli KTE12 tRNA-Phe
  2543. Escherichia coli KTE130 tRNA-Phe
  2544. Escherichia coli KTE131 tRNA-Phe
  2545. Escherichia coli KTE132 tRNA-Phe
  2546. Escherichia coli KTE133 tRNA-Phe
  2547. Escherichia coli KTE134 tRNA-Phe
  2548. Escherichia coli KTE135 tRNA-Phe
  2549. Escherichia coli KTE136 tRNA-Phe
  2550. Escherichia coli KTE137 tRNA-Phe
  2551. Escherichia coli KTE138 tRNA-Phe
  2552. Escherichia coli KTE139 tRNA-Phe
  2553. Escherichia coli KTE13 tRNA-Phe
  2554. Escherichia coli KTE140 tRNA-Phe
  2555. Escherichia coli KTE141 tRNA-Phe
  2556. Escherichia coli KTE142 tRNA-Phe
  2557. Escherichia coli KTE143 tRNA-Phe
  2558. Escherichia coli KTE144 tRNA-Phe
  2559. Escherichia coli KTE145 tRNA-Phe
  2560. Escherichia coli KTE146 tRNA-Phe
  2561. Escherichia coli KTE147 tRNA-Phe
  2562. Escherichia coli KTE148 tRNA-Phe
  2563. Escherichia coli KTE14 tRNA-Phe
  2564. Escherichia coli KTE150 tRNA-Phe
  2565. Escherichia coli KTE153 tRNA-Phe
  2566. Escherichia coli KTE154 tRNA-Phe
  2567. Escherichia coli KTE155 tRNA-Phe
  2568. Escherichia coli KTE156 tRNA-Phe
  2569. Escherichia coli KTE157 tRNA-Phe
  2570. Escherichia coli KTE158 tRNA-Phe
  2571. Escherichia coli KTE15 tRNA-Phe
  2572. Escherichia coli KTE160 tRNA-Phe
  2573. Escherichia coli KTE161 tRNA-Phe
  2574. Escherichia coli KTE162 tRNA-Phe
  2575. Escherichia coli KTE163 tRNA-Phe
  2576. Escherichia coli KTE165 tRNA-Phe
  2577. Escherichia coli KTE166 tRNA-Phe
  2578. Escherichia coli KTE167 tRNA-Phe
  2579. Escherichia coli KTE168 tRNA-Phe
  2580. Escherichia coli KTE169 tRNA-Phe
  2581. Escherichia coli KTE16 tRNA-Phe
  2582. Escherichia coli KTE170 tRNA-Phe
  2583. Escherichia coli KTE171 tRNA-Phe
  2584. Escherichia coli KTE173 tRNA-Phe
  2585. Escherichia coli KTE174 tRNA-Phe
  2586. Escherichia coli KTE175 tRNA-Phe
  2587. Escherichia coli KTE176 tRNA-Phe
  2588. Escherichia coli KTE177 tRNA-Phe
  2589. Escherichia coli KTE178 tRNA-Phe
  2590. Escherichia coli KTE179 tRNA-Phe
  2591. Escherichia coli KTE17 tRNA-Phe
  2592. Escherichia coli KTE180 tRNA-Phe
  2593. Escherichia coli KTE181 tRNA-Phe
  2594. Escherichia coli KTE182 tRNA-Phe
  2595. Escherichia coli KTE183 tRNA-Phe
  2596. Escherichia coli KTE184 tRNA-Phe
  2597. Escherichia coli KTE185 tRNA-Phe
  2598. Escherichia coli KTE186 tRNA-Phe
  2599. Escherichia coli KTE187 tRNA-Phe
  2600. Escherichia coli KTE188 tRNA-Phe
  2601. Escherichia coli KTE189 tRNA-Phe
  2602. Escherichia coli KTE18 tRNA-Phe
  2603. Escherichia coli KTE190 tRNA-Phe
  2604. Escherichia coli KTE191 tRNA-Phe
  2605. Escherichia coli KTE192 tRNA-Phe
  2606. Escherichia coli KTE193 tRNA-Phe
  2607. Escherichia coli KTE194 tRNA-Phe
  2608. Escherichia coli KTE195 tRNA-Phe
  2609. Escherichia coli KTE196 tRNA-Phe
  2610. Escherichia coli KTE197 tRNA-Phe
  2611. Escherichia coli KTE198 tRNA-Phe
  2612. Escherichia coli KTE199 tRNA-Phe
  2613. Escherichia coli KTE19 tRNA-Phe
  2614. Escherichia coli KTE1 tRNA-Phe
  2615. Escherichia coli KTE200 tRNA-Phe
  2616. Escherichia coli KTE201 tRNA-Phe
  2617. Escherichia coli KTE202 tRNA-Phe
  2618. Escherichia coli KTE203 tRNA-Phe
  2619. Escherichia coli KTE204 tRNA-Phe
  2620. Escherichia coli KTE205 tRNA-Phe
  2621. Escherichia coli KTE206 tRNA-Phe
  2622. Escherichia coli KTE207 tRNA-Phe
  2623. Escherichia coli KTE208 tRNA-Phe
  2624. Escherichia coli KTE209 tRNA-Phe
  2625. Escherichia coli KTE20 tRNA-Phe
  2626. Escherichia coli KTE210 tRNA-Phe
  2627. Escherichia coli KTE211 tRNA-Phe
  2628. Escherichia coli KTE212 tRNA-Phe
  2629. Escherichia coli KTE213 tRNA-Phe
  2630. Escherichia coli KTE214 tRNA-Phe
  2631. Escherichia coli KTE215 tRNA-Phe
  2632. Escherichia coli KTE216 tRNA-Phe
  2633. Escherichia coli KTE217 tRNA-Phe
  2634. Escherichia coli KTE218 tRNA-Phe
  2635. Escherichia coli KTE219 tRNA-Phe
  2636. Escherichia coli KTE21 tRNA-Phe
  2637. Escherichia coli KTE220 tRNA-Phe
  2638. Escherichia coli KTE221 tRNA-Phe
  2639. Escherichia coli KTE222 tRNA-Phe
  2640. Escherichia coli KTE223 tRNA-Phe
  2641. Escherichia coli KTE224 tRNA-Phe
  2642. Escherichia coli KTE225 tRNA-Phe
  2643. Escherichia coli KTE226 tRNA-Phe
  2644. Escherichia coli KTE227 tRNA-Phe
  2645. Escherichia coli KTE228 tRNA-Phe
  2646. Escherichia coli KTE229 tRNA-Phe
  2647. Escherichia coli KTE22 tRNA-Phe
  2648. Escherichia coli KTE230 tRNA-Phe
  2649. Escherichia coli KTE231 tRNA-Phe
  2650. Escherichia coli KTE232 tRNA-Phe
  2651. Escherichia coli KTE233 tRNA-Phe
  2652. Escherichia coli KTE234 tRNA-Phe
  2653. Escherichia coli KTE235 tRNA-Phe
  2654. Escherichia coli KTE236 tRNA-Phe
  2655. Escherichia coli KTE237 tRNA-Phe
  2656. Escherichia coli KTE23 tRNA-Phe
  2657. Escherichia coli KTE240 tRNA-Phe
  2658. Escherichia coli KTE24 tRNA-Phe
  2659. Escherichia coli KTE25 tRNA-Phe
  2660. Escherichia coli KTE26 tRNA-Phe
  2661. Escherichia coli KTE27 tRNA-Phe
  2662. Escherichia coli KTE28 tRNA-Phe
  2663. Escherichia coli KTE29 tRNA-Phe
  2664. Escherichia coli KTE2 tRNA-Phe
  2665. Escherichia coli KTE34 tRNA-Phe
  2666. Escherichia coli KTE35 tRNA-Phe
  2667. Escherichia coli KTE36 tRNA-Phe
  2668. Escherichia coli KTE37 tRNA-Phe
  2669. Escherichia coli KTE38 tRNA-Phe
  2670. Escherichia coli KTE39 tRNA-Phe
  2671. Escherichia coli KTE3 tRNA-Phe
  2672. Escherichia coli KTE40 tRNA-Phe
  2673. Escherichia coli KTE41 tRNA-Phe
  2674. Escherichia coli KTE42 tRNA-Phe
  2675. Escherichia coli KTE43 tRNA-Phe
  2676. Escherichia coli KTE44 tRNA-Phe
  2677. Escherichia coli KTE45 tRNA-Phe
  2678. Escherichia coli KTE46 tRNA-Phe
  2679. Escherichia coli KTE47 tRNA-Phe
  2680. Escherichia coli KTE48 tRNA-Phe
  2681. Escherichia coli KTE49 tRNA-Phe
  2682. Escherichia coli KTE4 tRNA-Phe
  2683. Escherichia coli KTE50 tRNA-Phe
  2684. Escherichia coli KTE51 tRNA-Phe
  2685. Escherichia coli KTE53 tRNA-Phe
  2686. Escherichia coli KTE54 tRNA-Phe
  2687. Escherichia coli KTE55 tRNA-Phe
  2688. Escherichia coli KTE56 tRNA-Phe
  2689. Escherichia coli KTE57 tRNA-Phe
  2690. Escherichia coli KTE58 tRNA-Phe
  2691. Escherichia coli KTE59 tRNA-Phe
  2692. Escherichia coli KTE5 tRNA-Phe
  2693. Escherichia coli KTE60 tRNA-Phe
  2694. Escherichia coli KTE61 tRNA-Phe
  2695. Escherichia coli KTE62 tRNA-Phe
  2696. Escherichia coli KTE63 tRNA-Phe
  2697. Escherichia coli KTE64 tRNA-Phe
  2698. Escherichia coli KTE65 tRNA-Phe
  2699. Escherichia coli KTE66 tRNA-Phe
  2700. Escherichia coli KTE67 tRNA-Phe
  2701. Escherichia coli KTE68 tRNA-Phe
  2702. Escherichia coli KTE69 tRNA-Phe
  2703. Escherichia coli KTE6 tRNA-Phe
  2704. Escherichia coli KTE70 tRNA-Phe
  2705. Escherichia coli KTE71 tRNA-Phe
  2706. Escherichia coli KTE72 tRNA-Phe
  2707. Escherichia coli KTE73 tRNA-Phe
  2708. Escherichia coli KTE74 tRNA-Phe
  2709. Escherichia coli KTE76 tRNA-Phe
  2710. Escherichia coli KTE77 tRNA-Phe
  2711. Escherichia coli KTE78 tRNA-Phe
  2712. Escherichia coli KTE79 tRNA-Phe
  2713. Escherichia coli KTE7 tRNA-Phe
  2714. Escherichia coli KTE80 tRNA-Phe
  2715. Escherichia coli KTE81 tRNA-Phe
  2716. Escherichia coli KTE82 tRNA-Phe
  2717. Escherichia coli KTE83 tRNA-Phe
  2718. Escherichia coli KTE84 tRNA-Phe
  2719. Escherichia coli KTE85 tRNA-Phe
  2720. Escherichia coli KTE86 tRNA-Phe
  2721. Escherichia coli KTE87 tRNA-Phe
  2722. Escherichia coli KTE88 tRNA-Phe
  2723. Escherichia coli KTE89 tRNA-Phe
  2724. Escherichia coli KTE8 tRNA-Phe
  2725. Escherichia coli KTE90 tRNA-Phe
  2726. Escherichia coli KTE91 tRNA-Phe
  2727. Escherichia coli KTE93 tRNA-Phe
  2728. Escherichia coli KTE94 tRNA-Phe
  2729. Escherichia coli KTE95 tRNA-Phe
  2730. Escherichia coli KTE97 tRNA-Phe
  2731. Escherichia coli KTE98 tRNA-Phe
  2732. Escherichia coli KTE99 tRNA-Phe
  2733. Escherichia coli KTE9 tRNA-Phe
  2734. Escherichia coli LAU-EC10 tRNA-Phe
  2735. Escherichia coli LAU-EC6 tRNA-Phe
  2736. Escherichia coli LAU-EC7 tRNA-Phe
  2737. Escherichia coli LAU-EC8 tRNA-Phe
  2738. Escherichia coli LAU-EC9 tRNA-Phe
  2739. Escherichia coli LF82 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2740. Escherichia coli LT-68 tRNA-Phe
  2741. Escherichia coli LY180 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2742. Escherichia coli M056 tRNA-Phe
  2743. Escherichia coli M114 tRNA-Phe
  2744. Escherichia coli M12 tRNA-Phe
  2745. Escherichia coli M4 tRNA-Phe
  2746. Escherichia coli M605 tRNA-Phe
  2747. Escherichia coli M718 tRNA-Phe
  2748. Escherichia coli M863 tRNA-Phe
  2749. Escherichia coli M8 tRNA-Phe
  2750. Escherichia coli M919 tRNA-Phe
  2751. Escherichia coli MA6 tRNA-Phe
  2752. Escherichia coli MGH 57 tRNA-Phe
  2753. Escherichia coli MGH 58 tRNA-Phe
  2754. Escherichia coli MH5800 tRNA-Phe
  2755. Escherichia coli MP020940.1 tRNA-Phe
  2756. Escherichia coli MP020980.1 tRNA-Phe
  2757. Escherichia coli MP020980.2 tRNA-Phe
  2758. Escherichia coli MP021017.10 tRNA-Phe
  2759. Escherichia coli MP021017.11 tRNA-Phe
  2760. Escherichia coli MP021017.12 tRNA-Phe
  2761. Escherichia coli MP021017.1 tRNA-Phe
  2762. Escherichia coli MP021017.2 tRNA-Phe
  2763. Escherichia coli MP021017.3 tRNA-Phe
  2764. Escherichia coli MP021017.4 tRNA-Phe
  2765. Escherichia coli MP021017.5 tRNA-Phe
  2766. Escherichia coli MP021017.6 tRNA-Phe
  2767. Escherichia coli MP021017.9 tRNA-Phe
  2768. Escherichia coli MP021552.11 tRNA-Phe
  2769. Escherichia coli MP021552.12 tRNA-Phe
  2770. Escherichia coli MP021552.7 tRNA-Phe
  2771. Escherichia coli MP021552.8 tRNA-Phe
  2772. Escherichia coli MP021561.2 tRNA-Phe
  2773. Escherichia coli MP021561.3 tRNA-Phe
  2774. Escherichia coli MP021566.1 tRNA-Phe
  2775. Escherichia coli MP1 tRNA-Phe
  2776. Escherichia coli MRSN 10204 tRNA-Phe
  2777. Escherichia coli MS 107-1 tRNA-Phe
  2778. Escherichia coli MS 110-3 tRNA-Phe
  2779. Escherichia coli MS 115-1 tRNA-Phe
  2780. Escherichia coli MS 116-1 tRNA-Phe
  2781. Escherichia coli MS 119-7 tRNA-Phe
  2782. Escherichia coli MS 124-1 tRNA-Phe
  2783. Escherichia coli MS 145-7 tRNA-Phe
  2784. Escherichia coli MS 146-1 tRNA-Phe
  2785. Escherichia coli MS 153-1 tRNA-Phe
  2786. Escherichia coli MS 16-3 tRNA-Phe
  2787. Escherichia coli MS 175-1 tRNA-Phe
  2788. Escherichia coli MS 182-1 tRNA-Phe
  2789. Escherichia coli MS 185-1 tRNA-Phe
  2790. Escherichia coli MS 187-1 tRNA-Phe
  2791. Escherichia coli MS 196-1 tRNA-Phe
  2792. Escherichia coli MS 198-1 tRNA-Phe
  2793. Escherichia coli MS 200-1 tRNA-Phe
  2794. Escherichia coli MS 21-1 tRNA-Phe
  2795. Escherichia coli MS 45-1 tRNA-Phe
  2796. Escherichia coli MS 57-2 tRNA-Phe
  2797. Escherichia coli MS 60-1 tRNA-Phe
  2798. Escherichia coli MS 69-1 tRNA-Phe
  2799. Escherichia coli MS 78-1 tRNA-Phe
  2800. Escherichia coli MS 79-10 tRNA-Phe
  2801. Escherichia coli MS 84-1 tRNA-Phe
  2802. Escherichia coli MS 85-1 tRNA-Phe
  2803. Escherichia coli MVAST0036 tRNA-Phe
  2804. Escherichia coli MVAST014 tRNA-Phe
  2805. Escherichia coli MVAST020 tRNA-Phe
  2806. Escherichia coli MVAST038 tRNA-Phe
  2807. Escherichia coli MVAST046 tRNA-Phe
  2808. Escherichia coli MVAST077 tRNA-Phe
  2809. Escherichia coli MVAST084 tRNA-Phe
  2810. Escherichia coli MVAST131 tRNA-Phe
  2811. Escherichia coli MVAST158 tRNA-Phe
  2812. Escherichia coli MVAST167 tRNA-Phe
  2813. Escherichia coli MVAST179 tRNA-Phe
  2814. Escherichia coli N1 tRNA-Phe
  2815. Escherichia coli N36254PS tRNA-Phe
  2816. Escherichia coli N36410PS tRNA-Phe
  2817. Escherichia coli N37058PS tRNA-Phe
  2818. Escherichia coli N37122PS tRNA-Phe
  2819. Escherichia coli N37139PS tRNA-Phe
  2820. Escherichia coli N40513 tRNA-Phe
  2821. Escherichia coli N40607 tRNA-Phe
  2822. Escherichia coli NA114 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  2823. Escherichia coli NB8 tRNA-Phe
  2824. Escherichia coli NC101 tRNA-Phe
  2825. Escherichia coli NCCP15648 tRNA-Phe
  2826. Escherichia coli NCTC 50110 tRNA-Phe
  2827. Escherichia coli NE037 tRNA-Phe
  2828. Escherichia coli NE098 tRNA-Phe
  2829. Escherichia coli NE1487 tRNA-Phe
  2830. Escherichia coli Nissle 1917 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2831. Escherichia coli NU14 tRNA-Phe
  2832. Escherichia coli O08 tRNA-Phe
  2833. Escherichia coli O100:H12 tRNA-Phe
  2834. Escherichia coli O100:H21 tRNA-Phe
  2835. Escherichia coli O100 tRNA-Phe
  2836. Escherichia coli O101,9,9a:H9 tRNA-Phe
  2837. Escherichia coli O101:H10 tRNA-Phe
  2838. Escherichia coli O101:H45 tRNA-Phe
  2839. Escherichia coli O101:H4 tRNA-Phe
  2840. Escherichia coli O101:H9 tRNA-Phe
  2841. Escherichia coli O101 tRNA-Phe
  2842. Escherichia coli O102:H25 tRNA-Phe
  2843. Escherichia coli O102:H32 tRNA-Phe
  2844. Escherichia coli O102:H6 tRNA-Phe
  2845. Escherichia coli O102 tRNA-Phe
  2846. Escherichia coli O103:H11 str. 04-3023 tRNA-Phe
  2847. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Phe
  2848. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Phe
  2849. Escherichia coli O103:H25 str. CVM9340 tRNA-Phe
  2850. Escherichia coli O103:H2 str. 12009 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2851. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Phe
  2852. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Phe
  2853. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Phe
  2854. Escherichia coli O103:H2 str. CVM9450 tRNA-Phe
  2855. Escherichia coli O103:H2 tRNA-Phe
  2856. Escherichia coli O103:H43 tRNA-Phe
  2857. Escherichia coli O103 str. RM8385 tRNA-Phe
  2858. Escherichia coli O103 tRNA-Phe
  2859. Escherichia coli O104:H21 str. 94-3025 tRNA-Phe
  2860. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Phe
  2861. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Phe
  2862. Escherichia coli O104:H4 str. 01-09591 tRNA-Phe
  2863. Escherichia coli O104:H4 str. 04-8351 tRNA-Phe
  2864. Escherichia coli O104:H4 str. 09-7901 tRNA-Phe
  2865. Escherichia coli O104:H4 str. 11-02030 tRNA-Phe
  2866. Escherichia coli O104:H4 str. 11-02033-1 tRNA-Phe
  2867. Escherichia coli O104:H4 str. 11-02092 tRNA-Phe
  2868. Escherichia coli O104:H4 str. 11-02093 tRNA-Phe
  2869. Escherichia coli O104:H4 str. 11-02281 tRNA-Phe
  2870. Escherichia coli O104:H4 str. 11-02318 tRNA-Phe
  2871. Escherichia coli O104:H4 str. 11-02913 tRNA-Phe
  2872. Escherichia coli O104:H4 str. 11-03439 tRNA-Phe
  2873. Escherichia coli O104:H4 str. 11-03943 tRNA-Phe
  2874. Escherichia coli O104:H4 str. 11-04080 tRNA-Phe
  2875. Escherichia coli O104:H4 str. 11-3677 tRNA-Phe
  2876. Escherichia coli O104:H4 str. 11-3798 tRNA-Phe
  2877. Escherichia coli O104:H4 str. 11-4404 tRNA-Phe
  2878. Escherichia coli O104:H4 str. 11-4522 tRNA-Phe
  2879. Escherichia coli O104:H4 str. 11-4623 tRNA-Phe
  2880. Escherichia coli O104:H4 str. 11-4632 C1 tRNA-Phe
  2881. Escherichia coli O104:H4 str. 11-4632 C2 tRNA-Phe
  2882. Escherichia coli O104:H4 str. 11-4632 C3 tRNA-Phe
  2883. Escherichia coli O104:H4 str. 11-4632 C4 tRNA-Phe
  2884. Escherichia coli O104:H4 str. 11-4632 C5 tRNA-Phe
  2885. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2886. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2887. Escherichia coli O104:H4 str. 2011C-3493 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2888. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Phe
  2889. Escherichia coli O104:H4 str. C227-11 tRNA-Phe
  2890. Escherichia coli O104:H4 str. C236-11 tRNA-Phe
  2891. Escherichia coli O104:H4 str. E112/10 tRNA-Phe
  2892. Escherichia coli O104:H4 str. E92/11 tRNA-Phe
  2893. Escherichia coli O104:H4 str. Ec11-4984 tRNA-Phe
  2894. Escherichia coli O104:H4 str. Ec11-4986 tRNA-Phe
  2895. Escherichia coli O104:H4 str. Ec11-4987 tRNA-Phe
  2896. Escherichia coli O104:H4 str. Ec11-4988 tRNA-Phe
  2897. Escherichia coli O104:H4 str. Ec11-5536 tRNA-Phe
  2898. Escherichia coli O104:H4 str. Ec11-5537 tRNA-Phe
  2899. Escherichia coli O104:H4 str. Ec11-5538 tRNA-Phe
  2900. Escherichia coli O104:H4 str. Ec11-5603 tRNA-Phe
  2901. Escherichia coli O104:H4 str. Ec11-5604 tRNA-Phe
  2902. Escherichia coli O104:H4 str. Ec11-6006 tRNA-Phe
  2903. Escherichia coli O104:H4 str. Ec11-9450 tRNA-Phe
  2904. Escherichia coli O104:H4 str. Ec11-9941 tRNA-Phe
  2905. Escherichia coli O104:H4 str. Ec11-9990 tRNA-Phe
  2906. Escherichia coli O104:H4 str. Ec12-0465 tRNA-Phe
  2907. Escherichia coli O104:H4 str. Ec12-0466 tRNA-Phe
  2908. Escherichia coli O104:H4 str. LB226692 tRNA-Phe
  2909. Escherichia coli O104:H4 tRNA-Phe
  2910. Escherichia coli O104:H7 tRNA-Phe
  2911. Escherichia coli O104 tRNA-Phe
  2912. Escherichia coli O105:H7 tRNA-Phe
  2913. Escherichia coli O105 tRNA-Phe
  2914. Escherichia coli O106,17,77,73:H45 tRNA-Phe
  2915. Escherichia coli O106:H18 tRNA-Phe
  2916. Escherichia coli O106 tRNA-Phe
  2917. Escherichia coli O107:H10 tRNA-Phe
  2918. Escherichia coli O107 tRNA-Phe
  2919. Escherichia coli O108:H9 tRNA-Phe
  2920. Escherichia coli O109:H21 tRNA-Phe
  2921. Escherichia coli O109:H27 tRNA-Phe
  2922. Escherichia coli O109:H40 tRNA-Phe
  2923. Escherichia coli O109:H45 tRNA-Phe
  2924. Escherichia coli O109:H4 tRNA-Phe
  2925. Escherichia coli O109:H7 tRNA-Phe
  2926. Escherichia coli O109 tRNA-Phe
  2927. Escherichia coli O10:H26 tRNA-Phe
  2928. Escherichia coli O10:H32 tRNA-Phe
  2929. Escherichia coli O10:K5(L):H4 str. ATCC 23506 tRNA-Phe-GAA
  2930. Escherichia coli O10 str. Bi8337-41 tRNA-Phe
  2931. Escherichia coli O10 tRNA-Phe
  2932. Escherichia coli O110:H10 tRNA-Phe
  2933. Escherichia coli O110:H2 tRNA-Phe
  2934. Escherichia coli O110:H5 tRNA-Phe
  2935. Escherichia coli O110 tRNA-Phe
  2936. Escherichia coli O111:H11 str. CFSAN001630 tRNA-Phe
  2937. Escherichia coli O111:H11 str. CVM9455 tRNA-Phe
  2938. Escherichia coli O111:H11 str. CVM9534 tRNA-Phe
  2939. Escherichia coli O111:H11 str. CVM9545 tRNA-Phe
  2940. Escherichia coli O111:H11 str. CVM9553 tRNA-Phe
  2941. Escherichia coli O111:H11 tRNA-Phe
  2942. Escherichia coli O111:H21 tRNA-Phe
  2943. Escherichia coli O111:H2 tRNA-Phe
  2944. Escherichia coli O111:H5 tRNA-Phe
  2945. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Phe
  2946. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Phe
  2947. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Phe
  2948. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Phe
  2949. Escherichia coli O111:H8 str. CVM9570 tRNA-Phe
  2950. Escherichia coli O111:H8 str. CVM9574 tRNA-Phe
  2951. Escherichia coli O111:H8 str. CVM9602 tRNA-Phe
  2952. Escherichia coli O111:H8 str. CVM9634 tRNA-Phe
  2953. Escherichia coli O111:H8 str. F6627 tRNA-Phe
  2954. Escherichia coli O111:H8 tRNA-Phe
  2955. Escherichia coli O111:H- str. 11128 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  2956. Escherichia coli O111:H- tRNA-Phe (GAA)
  2957. Escherichia coli O111:NM str. 01-3076 tRNA-Phe
  2958. Escherichia coli O111:NM str. 03-3484 tRNA-Phe
  2959. Escherichia coli O111:NM str. 04-3211 tRNA-Phe
  2960. Escherichia coli O111:NM str. 08-4487 tRNA-Phe
  2961. Escherichia coli O111:NM str. 2009C-4006 tRNA-Phe
  2962. Escherichia coli O111:NM str. 2009C-4052 tRNA-Phe
  2963. Escherichia coli O111:NM str. 2010C-3053 tRNA-Phe
  2964. Escherichia coli O111:NM str. 2010C-3977 tRNA-Phe
  2965. Escherichia coli O111:NM str. 2010C-4086 tRNA-Phe
  2966. Escherichia coli O111:NM str. 2010C-4221 tRNA-Phe
  2967. Escherichia coli O111:NM str. 2010C-4592 tRNA-Phe
  2968. Escherichia coli O111:NM str. 2010C-4622 tRNA-Phe
  2969. Escherichia coli O111:NM str. 2010C-4715 tRNA-Phe
  2970. Escherichia coli O111:NM str. 2010C-4735 tRNA-Phe
  2971. Escherichia coli O111:NM str. 2010C-4746 tRNA-Phe
  2972. Escherichia coli O111:NM str. 2010C-4799 tRNA-Phe
  2973. Escherichia coli O111:NM str. 2010C-4818 tRNA-Phe
  2974. Escherichia coli O111:NM str. 2011C-3170 tRNA-Phe
  2975. Escherichia coli O111:NM str. 2011C-3362 tRNA-Phe
  2976. Escherichia coli O111:NM str. 2011C-3573 tRNA-Phe
  2977. Escherichia coli O111:NM str. 2011C-3632 tRNA-Phe
  2978. Escherichia coli O111:NM str. 2011C-3679 tRNA-Phe
  2979. Escherichia coli O111:NM str. K6722 tRNA-Phe
  2980. Escherichia coli O111:NM str. K6723 tRNA-Phe
  2981. Escherichia coli O111:NM str. K6728 tRNA-Phe
  2982. Escherichia coli O111:NM str. K6890 tRNA-Phe
  2983. Escherichia coli O111:NM str. K6895 tRNA-Phe
  2984. Escherichia coli O111:NM str. K6897 tRNA-Phe
  2985. Escherichia coli O111:NM str. K6898 tRNA-Phe
  2986. Escherichia coli O111:NM str. K6904 tRNA-Phe
  2987. Escherichia coli O111:NM str. K6908 tRNA-Phe
  2988. Escherichia coli O111:NM str. K6915 tRNA-Phe
  2989. Escherichia coli O111:NM tRNA-Phe
  2990. Escherichia coli O111 str. RM9322 tRNA-Phe
  2991. Escherichia coli O111 tRNA-Phe
  2992. Escherichia coli O112ab:H8 tRNA-Phe
  2993. Escherichia coli O112ab:H9 tRNA-Phe
  2994. Escherichia coli O112ac:H20 tRNA-Phe
  2995. Escherichia coli O112 tRNA-Phe
  2996. Escherichia coli O113:H21 str. 07-4224 tRNA-Phe
  2997. Escherichia coli O113:H21 tRNA-Phe
  2998. Escherichia coli O113:H32 tRNA-Phe
  2999. Escherichia coli O113:H36 tRNA-Phe
  3000. Escherichia coli O113:H4 tRNA-Phe
  3001. Escherichia coli O113 tRNA-Phe
  3002. Escherichia coli O113w tRNA-Phe
  3003. Escherichia coli O114:H31 tRNA-Phe
  3004. Escherichia coli O115:H10 tRNA-Phe
  3005. Escherichia coli O115:H20 tRNA-Phe
  3006. Escherichia coli O115:H4 tRNA-Phe
  3007. Escherichia coli O115:H51 tRNA-Phe
  3008. Escherichia coli O115 tRNA-Phe
  3009. Escherichia coli O116:H51 tRNA-Phe
  3010. Escherichia coli O116 tRNA-Phe
  3011. Escherichia coli O117:H42 tRNA-Phe
  3012. Escherichia coli O117:H4 tRNA-Phe
  3013. Escherichia coli O117 tRNA-Phe
  3014. Escherichia coli O118:H16 str. 07-4255 tRNA-Phe
  3015. Escherichia coli O118:H16 str. 08-3651 tRNA-Phe
  3016. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Phe
  3017. Escherichia coli O119:H4 str. 03-3458 tRNA-Phe
  3018. Escherichia coli O119 tRNA-Phe
  3019. Escherichia coli O11:H15 tRNA-Phe
  3020. Escherichia coli O11:H16,53 tRNA-Phe
  3021. Escherichia coli O11:H25 tRNA-Phe
  3022. Escherichia coli O11:H4 tRNA-Phe
  3023. Escherichia coli O11:H5 tRNA-Phe
  3024. Escherichia coli O11:H6 tRNA-Phe
  3025. Escherichia coli O11 str. Bi632-42 tRNA-Phe
  3026. Escherichia coli O11 tRNA-Phe
  3027. Escherichia coli O120:H10 tRNA-Phe
  3028. Escherichia coli O120:H1 tRNA-Phe
  3029. Escherichia coli O120:H4 tRNA-Phe
  3030. Escherichia coli O120 tRNA-Phe
  3031. Escherichia coli O121:H11 tRNA-Phe
  3032. Escherichia coli O121:H19 str. 03-3227 tRNA-Phe
  3033. Escherichia coli O121:H19 str. 06-3003 tRNA-Phe
  3034. Escherichia coli O121:H19 str. 06-3822 tRNA-Phe
  3035. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Phe
  3036. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Phe
  3037. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Phe
  3038. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Phe
  3039. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Phe
  3040. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Phe
  3041. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Phe
  3042. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Phe
  3043. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Phe
  3044. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Phe
  3045. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Phe
  3046. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Phe
  3047. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Phe
  3048. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Phe
  3049. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Phe
  3050. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Phe
  3051. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Phe
  3052. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Phe
  3053. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Phe
  3054. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Phe
  3055. Escherichia coli O121:H19 str. F6714 tRNA-Phe
  3056. Escherichia coli O121:H19 str. K5198 tRNA-Phe
  3057. Escherichia coli O121:H19 str. K5269 tRNA-Phe
  3058. Escherichia coli O121:H19 tRNA-Phe
  3059. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Phe
  3060. Escherichia coli O121 str. RM8352 tRNA-Phe
  3061. Escherichia coli O121 tRNA-Phe
  3062. Escherichia coli O123/186:H25 tRNA-Phe
  3063. Escherichia coli O123,186:H40 tRNA-Phe
  3064. Escherichia coli O123/186:H40 tRNA-Phe
  3065. Escherichia coli O123/O186:H49 tRNA-Phe
  3066. Escherichia coli O124 tRNA-Phe
  3067. Escherichia coli O125ac:K+:H10 tRNA-Phe
  3068. Escherichia coli O125:H19 tRNA-Phe
  3069. Escherichia coli O126:H19 tRNA-Phe
  3070. Escherichia coli O126:H45 tRNA-Phe
  3071. Escherichia coli O126 tRNA-Phe
  3072. Escherichia coli O127:H27 str. C43/90 tRNA-Phe
  3073. Escherichia coli O127:H40 tRNA-Phe
  3074. Escherichia coli O127:H6 str. E2348/69 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3075. Escherichia coli O127:H6 tRNA-Phe
  3076. Escherichia coli O128AB:H2 tRNA-Phe
  3077. Escherichia coli O128ac:H12 tRNA-Phe
  3078. Escherichia coli O128ac:H26 tRNA-Phe
  3079. Escherichia coli O128AC:H2 tRNA-Phe
  3080. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Phe
  3081. Escherichia coli O128:H2 tRNA-Phe
  3082. Escherichia coli O128:H42 tRNA-Phe
  3083. Escherichia coli O128 tRNA-Phe
  3084. Escherichia coli O12:H48 tRNA-Phe
  3085. Escherichia coli O130:H26 tRNA-Phe
  3086. Escherichia coli O130 tRNA-Phe
  3087. Escherichia coli O13,129, 135:H11 tRNA-Phe
  3088. Escherichia coli O13,129,135:H11 tRNA-Phe
  3089. Escherichia coli O13,129, 135:H26 tRNA-Phe
  3090. Escherichia coli O13/129/135:H4 tRNA-Phe
  3091. Escherichia coli O13,21,129,135:H11 tRNA-Phe
  3092. Escherichia coli O132:H11 tRNA-Phe
  3093. Escherichia coli O132:H21 tRNA-Phe
  3094. Escherichia coli O132 tRNA-Phe
  3095. Escherichia coli O133:H29 tRNA-Phe
  3096. Escherichia coli O134/46/8:H19 tRNA-Phe
  3097. Escherichia coli O134/46/8:H21 tRNA-Phe
  3098. Escherichia coli O134,46:H31 tRNA-Phe
  3099. Escherichia coli O134:H31 tRNA-Phe
  3100. Escherichia coli O134/O8:H19 tRNA-Phe
  3101. Escherichia coli O135 tRNA-Phe
  3102. Escherichia coli O136:H26 tRNA-Phe
  3103. Escherichia coli O136:H40 tRNA-Phe
  3104. Escherichia coli O136 tRNA-Phe
  3105. Escherichia coli O137:H41 tRNA-Phe
  3106. Escherichia coli O139:H19 tRNA-Phe
  3107. Escherichia coli O139:H1 tRNA-Phe
  3108. Escherichia coli O139:H28 str. E24377A tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3109. Escherichia coli O139 tRNA-Phe
  3110. Escherichia coli O13:H15 tRNA-Phe
  3111. Escherichia coli O13:H4 tRNA-Phe
  3112. Escherichia coli O13/O135:H23 tRNA-Phe
  3113. Escherichia coli O13/O135:H4 tRNA-Phe
  3114. Escherichia coli O13 tRNA-Phe
  3115. Escherichia coli O140:H14 tRNA-Phe
  3116. Escherichia coli O140:H32 tRNA-Phe
  3117. Escherichia coli O140:H48 tRNA-Phe
  3118. Escherichia coli O140 tRNA-Phe
  3119. Escherichia coli O141,141ab,141ac:H29 tRNA-Phe
  3120. Escherichia coli O141,141ab,141ac:H43 tRNA-Phe
  3121. Escherichia coli O141:H32 tRNA-Phe
  3122. Escherichia coli O141:H4 tRNA-Phe
  3123. Escherichia coli O143:H4 tRNA-Phe
  3124. Escherichia coli O144 tRNA-Phe
  3125. Escherichia coli O145:H25 str. 07-3858 tRNA-Phe
  3126. Escherichia coli O145:H25 tRNA-Phe
  3127. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Phe
  3128. Escherichia coli O145:H28 str. 4865/96 tRNA-Phe
  3129. Escherichia coli O145:H28 str. RM12581 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3130. Escherichia coli O145:H28 str. RM12761 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3131. Escherichia coli O145:H28 str. RM13514 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3132. Escherichia coli O145:H28 str. RM13516 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3133. Escherichia coli O145:H28 tRNA-Phe
  3134. Escherichia coli O145:H34 tRNA-Phe
  3135. Escherichia coli O145:NM str. 06-3484 tRNA-Phe
  3136. Escherichia coli O145:NM str. 08-4270 tRNA-Phe
  3137. Escherichia coli O145:NM str. 2010C-3507 tRNA-Phe
  3138. Escherichia coli O145:NM str. 2010C-3508 tRNA-Phe
  3139. Escherichia coli O145:NM str. 2010C-3509 tRNA-Phe
  3140. Escherichia coli O145:NM str. 2010C-3510 tRNA-Phe
  3141. Escherichia coli O145:NM str. 2010C-3511 tRNA-Phe
  3142. Escherichia coli O145:NM str. 2010C-3516 tRNA-Phe
  3143. Escherichia coli O145:NM str. 2010C-3517 tRNA-Phe
  3144. Escherichia coli O145:NM str. 2010C-3518 tRNA-Phe
  3145. Escherichia coli O145:NM str. 2010C-3521 tRNA-Phe
  3146. Escherichia coli O145:NM str. 2010C-3526 tRNA-Phe
  3147. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Phe
  3148. Escherichia coli O145:NM str. 2012C-4474 tRNA-Phe
  3149. Escherichia coli O145:NM str. 2012C-4477 tRNA-Phe
  3150. Escherichia coli O145:NM str. 2012C-4478 tRNA-Phe
  3151. Escherichia coli O145:NM str. 2012C-4479 tRNA-Phe
  3152. Escherichia coli O145:NM str. 2012C-4480 tRNA-Phe
  3153. Escherichia coli O145:NM tRNA-Phe
  3154. Escherichia coli O145 str. RM9872 tRNA-Phe
  3155. Escherichia coli O145 tRNA-Phe
  3156. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Phe
  3157. Escherichia coli O146:H21 tRNA-Phe
  3158. Escherichia coli O146:H28 tRNA-Phe
  3159. Escherichia coli O146 tRNA-Phe
  3160. Escherichia coli O147:H40 tRNA-Phe
  3161. Escherichia coli O148:H32 tRNA-Phe
  3162. Escherichia coli O148 tRNA-Phe
  3163. Escherichia coli O149:H2 tRNA-Phe
  3164. Escherichia coli O149 tRNA-Phe
  3165. Escherichia coli O14 tRNA-Phe
  3166. Escherichia coli O150:H11 tRNA-Phe
  3167. Escherichia coli O150:H6 tRNA-Phe
  3168. Escherichia coli O150 tRNA-Phe
  3169. Escherichia coli O151:H8 tRNA-Phe
  3170. Escherichia coli O152:H23 tRNA-Phe
  3171. Escherichia coli O152:H2 tRNA-Phe
  3172. Escherichia coli O152 tRNA-Phe
  3173. Escherichia coli O153:H12 tRNA-Phe
  3174. Escherichia coli O153:H21 tRNA-Phe
  3175. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Phe
  3176. Escherichia coli O153:H2 tRNA-Phe
  3177. Escherichia coli O153:H34 tRNA-Phe
  3178. Escherichia coli O153:H7 tRNA-Phe
  3179. Escherichia coli O153/O178:H19 tRNA-Phe
  3180. Escherichia coli O153/O178:H7 tRNA-Phe
  3181. Escherichia coli O153 tRNA-Phe
  3182. Escherichia coli O154:H16 tRNA-Phe
  3183. Escherichia coli O155:H21 tRNA-Phe
  3184. Escherichia coli O155/O8:H41 tRNA-Phe
  3185. Escherichia coli O155 tRNA-Phe
  3186. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Phe
  3187. Escherichia coli O156:H25 tRNA-Phe
  3188. Escherichia coli O156:H28 tRNA-Phe
  3189. Escherichia coli O156:H37 tRNA-Phe
  3190. Escherichia coli O156:H5 tRNA-Phe
  3191. Escherichia coli O156 tRNA-Phe
  3192. Escherichia coli O157:H11 tRNA-Phe
  3193. Escherichia coli O157:H16 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3194. Escherichia coli O157:H26 tRNA-Phe
  3195. Escherichia coli O157:H43 str. T22 tRNA-Phe
  3196. Escherichia coli O157:H43 tRNA-Phe
  3197. Escherichia coli O157:H45 tRNA-Phe
  3198. Escherichia coli O157:H51 tRNA-Phe
  3199. Escherichia coli O157:H7 str. 06-3745 tRNA-Phe
  3200. Escherichia coli O157:H7 str. 06-4039 tRNA-Phe
  3201. Escherichia coli O157:H7 str. 07-3091 tRNA-Phe
  3202. Escherichia coli O157:H7 str. 07-3391 tRNA-Phe
  3203. Escherichia coli O157:H7 str. 08-3037 tRNA-Phe
  3204. Escherichia coli O157:H7 str. 08-3527 tRNA-Phe
  3205. Escherichia coli O157:H7 str. 08-4169 tRNA-Phe
  3206. Escherichia coli O157:H7 str. 08-4529 tRNA-Phe
  3207. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Phe
  3208. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Phe
  3209. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Phe
  3210. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Phe
  3211. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Phe
  3212. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Phe
  3213. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Phe
  3214. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Phe
  3215. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Phe
  3216. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Phe
  3217. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Phe
  3218. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Phe
  3219. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Phe
  3220. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Phe
  3221. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Phe
  3222. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Phe
  3223. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Phe
  3224. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Phe
  3225. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Phe
  3226. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Phe
  3227. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Phe
  3228. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Phe
  3229. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Phe
  3230. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Phe
  3231. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Phe
  3232. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Phe
  3233. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Phe
  3234. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Phe
  3235. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Phe
  3236. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Phe
  3237. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Phe
  3238. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Phe
  3239. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Phe
  3240. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Phe
  3241. Escherichia coli O157:H7 str. EC10 tRNA-Phe
  3242. Escherichia coli O157:H7 str. EC1825 tRNA-Phe
  3243. Escherichia coli O157:H7 str. EC4115 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3244. Escherichia coli O157:H7 str. EDL933 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3245. Escherichia coli O157:H7 str. F6142 tRNA-Phe
  3246. Escherichia coli O157:H7 str. F6749 tRNA-Phe
  3247. Escherichia coli O157:H7 str. F6750 tRNA-Phe
  3248. Escherichia coli O157:H7 str. F6751 tRNA-Phe
  3249. Escherichia coli O157:H7 str. F7350 tRNA-Phe
  3250. Escherichia coli O157:H7 str. F7377 tRNA-Phe
  3251. Escherichia coli O157:H7 str. F7384 tRNA-Phe
  3252. Escherichia coli O157:H7 str. F7410 tRNA-Phe
  3253. Escherichia coli O157:H7 str. F8092B tRNA-Phe
  3254. Escherichia coli O157:H7 str. G5101 tRNA-Phe
  3255. Escherichia coli O157:H7 str. G5303 tRNA-Phe
  3256. Escherichia coli O157:H7 str. H2495 tRNA-Phe
  3257. Escherichia coli O157:H7 str. H2498 tRNA-Phe
  3258. Escherichia coli O157:H7 str. K1420 tRNA-Phe
  3259. Escherichia coli O157:H7 str. K1792 tRNA-Phe
  3260. Escherichia coli O157:H7 str. K1793 tRNA-Phe
  3261. Escherichia coli O157:H7 str. K1795 tRNA-Phe
  3262. Escherichia coli O157:H7 str. K1796 tRNA-Phe
  3263. Escherichia coli O157:H7 str. K1921 tRNA-Phe
  3264. Escherichia coli O157:H7 str. K1927 tRNA-Phe
  3265. Escherichia coli O157:H7 str. K2188 tRNA-Phe
  3266. Escherichia coli O157:H7 str. K2191 tRNA-Phe
  3267. Escherichia coli O157:H7 str. K2192 tRNA-Phe
  3268. Escherichia coli O157:H7 str. K2324 tRNA-Phe
  3269. Escherichia coli O157:H7 str. K2581 tRNA-Phe
  3270. Escherichia coli O157:H7 str. K2622 tRNA-Phe
  3271. Escherichia coli O157:H7 str. K2845 tRNA-Phe
  3272. Escherichia coli O157:H7 str. K2854 tRNA-Phe
  3273. Escherichia coli O157:H7 str. K4405 tRNA-Phe
  3274. Escherichia coli O157:H7 str. K4406 tRNA-Phe
  3275. Escherichia coli O157:H7 str. K4527 tRNA-Phe
  3276. Escherichia coli O157:H7 str. K5418 tRNA-Phe
  3277. Escherichia coli O157:H7 str. K5448 tRNA-Phe
  3278. Escherichia coli O157:H7 str. K5453 tRNA-Phe
  3279. Escherichia coli O157:H7 str. K5460 tRNA-Phe
  3280. Escherichia coli O157:H7 str. K5467 tRNA-Phe
  3281. Escherichia coli O157:H7 str. K5602 tRNA-Phe
  3282. Escherichia coli O157:H7 str. K5609 tRNA-Phe
  3283. Escherichia coli O157:H7 str. K5806 tRNA-Phe
  3284. Escherichia coli O157:H7 str. K5852 tRNA-Phe
  3285. Escherichia coli O157:H7 str. K6590 tRNA-Phe
  3286. Escherichia coli O157:H7 str. K6676 tRNA-Phe
  3287. Escherichia coli O157:H7 str. K6687 tRNA-Phe
  3288. Escherichia coli O157:H7 str. K7140 tRNA-Phe
  3289. Escherichia coli O157:H7 str. LSU-61 tRNA-Phe
  3290. Escherichia coli O157:H7 str. Sakai tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3291. Escherichia coli O157:H7 str. SS17 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3292. Escherichia coli O157:H7 str. SS52 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3293. Escherichia coli O157:H7 str. TW14313 tRNA-Phe
  3294. Escherichia coli O157:H7 str. TW14359 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  3295. Escherichia coli O157:H7 tRNA-Phe
  3296. Escherichia coli O157:H- str. 493-89 tRNA-Phe
  3297. Escherichia coli O157:H- str. H 2687 tRNA-Phe
  3298. Escherichia coli O157:H- tRNA-Phe
  3299. Escherichia coli O157:NM str. 08-4540 tRNA-Phe
  3300. Escherichia coli O157:NM tRNA-Phe
  3301. Escherichia coli O157: str. 2010EL-2044 tRNA-Phe
  3302. Escherichia coli O157: str. 2010EL-2045 tRNA-Phe
  3303. Escherichia coli O157 tRNA-Phe
  3304. Escherichia coli O158:H23 tRNA-Phe
  3305. Escherichia coli O158/O8:H27 tRNA-Phe
  3306. Escherichia coli O158 tRNA-Phe
  3307. Escherichia coli O159:H10 tRNA-Phe
  3308. Escherichia coli O159:H19 tRNA-Phe
  3309. Escherichia coli O159:H21 tRNA-Phe
  3310. Escherichia coli O15:H10 tRNA-Phe
  3311. Escherichia coli O15:H11 tRNA-Phe
  3312. Escherichia coli O15:H12 tRNA-Phe
  3313. Escherichia coli O15:H16 tRNA-Phe
  3314. Escherichia coli O15:H18 str. K1516 tRNA-Phe
  3315. Escherichia coli O15:H18 tRNA-Phe
  3316. Escherichia coli O15:H21 tRNA-Phe
  3317. Escherichia coli O15:H25 tRNA-Phe
  3318. Escherichia coli O15:H33 tRNA-Phe
  3319. Escherichia coli O15:H45 tRNA-Phe
  3320. Escherichia coli O15:H6 tRNA-Phe
  3321. Escherichia coli O15 tRNA-Phe
  3322. Escherichia coli O160,9:H2 tRNA-Phe
  3323. Escherichia coli O160:H34 tRNA-Phe
  3324. Escherichia coli O160 tRNA-Phe
  3325. Escherichia coli O161:H4 tRNA-Phe
  3326. Escherichia coli O162:H10 tRNA-Phe
  3327. Escherichia coli O162:H33 tRNA-Phe
  3328. Escherichia coli O162:H48 tRNA-Phe
  3329. Escherichia coli O162:H7 tRNA-Phe
  3330. Escherichia coli O162:H9 tRNA-Phe
  3331. Escherichia coli O162/O89:H9 tRNA-Phe
  3332. Escherichia coli O163:H38 tRNA-Phe
  3333. Escherichia coli O163 tRNA-Phe
  3334. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Phe
  3335. Escherichia coli O166:H15 tRNA-Phe
  3336. Escherichia coli O166:H16 tRNA-Phe
  3337. Escherichia coli O166:H25 tRNA-Phe
  3338. Escherichia coli O166:H28 tRNA-Phe
  3339. Escherichia coli O166:H45 tRNA-Phe
  3340. Escherichia coli O166:H49 tRNA-Phe
  3341. Escherichia coli O166:H6 tRNA-Phe
  3342. Escherichia coli O166:H7 tRNA-Phe
  3343. Escherichia coli O169:H41 tRNA-Phe
  3344. Escherichia coli O167:H9 tRNA-Phe
  3345. Escherichia coli O167 tRNA-Phe
  3346. Escherichia coli O168:H7 tRNA-Phe
  3347. Escherichia coli O168:H8 tRNA-Phe
  3348. Escherichia coli O168 tRNA-Phe
  3349. Escherichia coli O169:H41 str. F9792 tRNA-Phe
  3350. Escherichia coli O169:H41 tRNA-Phe
  3351. Escherichia coli O169 tRNA-Phe
  3352. Escherichia coli O16:H16 tRNA-Phe
  3353. Escherichia coli O16:H32 tRNA-Phe
  3354. Escherichia coli O16:H48 tRNA-Phe
  3355. Escherichia coli O16:H5 tRNA-Phe
  3356. Escherichia coli O16:H6 tRNA-Phe
  3357. Escherichia coli O16 tRNA-Phe
  3358. Escherichia coli O170:H18 tRNA-Phe
  3359. Escherichia coli O170:H5 tRNA-Phe
  3360. Escherichia coli O170 tRNA-Phe
  3361. Escherichia coli O171 tRNA-Phe
  3362. Escherichia coli O17,44,77:H18 tRNA-Phe
  3363. Escherichia coli O174:H10 tRNA-Phe
  3364. Escherichia coli O174:H21 str. 03-3269 tRNA-Phe
  3365. Escherichia coli O174:H21 tRNA-Phe
  3366. Escherichia coli O174:H7 tRNA-Phe
  3367. Escherichia coli O174:H8 str. 04-3038 tRNA-Phe
  3368. Escherichia coli O174:H8 tRNA-Phe
  3369. Escherichia coli O174 tRNA-Phe
  3370. Escherichia coli O175:H16 tRNA-Phe
  3371. Escherichia coli O175:H21 tRNA-Phe
  3372. Escherichia coli O175:H26 tRNA-Phe
  3373. Escherichia coli O175 tRNA-Phe
  3374. Escherichia coli O176:H40 tRNA-Phe
  3375. Escherichia coli O176:H45 tRNA-Phe
  3376. Escherichia coli O177:NM str. 2010C-4558 tRNA-Phe
  3377. Escherichia coli O177 tRNA-Phe
  3378. Escherichia coli O178:H7 tRNA-Phe
  3379. Escherichia coli O178 tRNA-Phe
  3380. Escherichia coli O179,8:H19 tRNA-Phe
  3381. Escherichia coli O179/8:H45 tRNA-Phe
  3382. Escherichia coli O179:H8 tRNA-Phe
  3383. Escherichia coli O17/O44/O77:H1 tRNA-Phe
  3384. Escherichia coli O17or77:H18 tRNA-Phe
  3385. Escherichia coli O17 tRNA-Phe
  3386. Escherichia coli O180:H14 tRNA-Phe
  3387. Escherichia coli O180:H48 tRNA-Phe
  3388. Escherichia coli O18/18ac:H49 tRNA-Phe
  3389. Escherichia coli O182:H16 tRNA-Phe
  3390. Escherichia coli O182:H23 tRNA-Phe
  3391. Escherichia coli O183:H18 tRNA-Phe
  3392. Escherichia coli O187:H28 tRNA-Phe
  3393. Escherichia coli O187:H4 tRNA-Phe
  3394. Escherichia coli O187:H52 tRNA-Phe
  3395. Escherichia coli O18ac:H14 tRNA-Phe
  3396. Escherichia coli O18:H14 tRNA-Phe
  3397. Escherichia coli O18:H1 tRNA-Phe
  3398. Escherichia coli O18:H49 tRNA-Phe
  3399. Escherichia coli O18:H7 tRNA-Phe
  3400. Escherichia coli O18 str. F10018-41 tRNA-Phe
  3401. Escherichia coli O19:H7 tRNA-Phe
  3402. Escherichia coli O19 tRNA-Phe
  3403. Escherichia coli O1:H27 tRNA-Phe
  3404. Escherichia coli O1:H28 tRNA-Phe
  3405. Escherichia coli O1:H32 tRNA-Phe
  3406. Escherichia coli O1:H33 tRNA-Phe
  3407. Escherichia coli O1:H42 tRNA-Phe
  3408. Escherichia coli O1:H7 tRNA-Phe
  3409. Escherichia coli O1:HNT tRNA-Phe
  3410. Escherichia coli O1:K1:H7 tRNA-Phe
  3411. Escherichia coli O1 tRNA-Phe
  3412. Escherichia coli O20:H12 tRNA-Phe
  3413. Escherichia coli O20:H45 tRNA-Phe
  3414. Escherichia coli O20:H9 tRNA-Phe
  3415. Escherichia coli O20 tRNA-Phe
  3416. Escherichia coli O21,81:H5,27 tRNA-Phe
  3417. Escherichia coli O21:H12 tRNA-Phe
  3418. Escherichia coli O21:H19 tRNA-Phe
  3419. Escherichia coli O21:H21 tRNA-Phe
  3420. Escherichia coli O21:H28 tRNA-Phe
  3421. Escherichia coli O21:H2 tRNA-Phe
  3422. Escherichia coli O21:H34 tRNA-Phe
  3423. Escherichia coli O21 tRNA-Phe
  3424. Escherichia coli O22:H8 tRNA-Phe
  3425. Escherichia coli O22 tRNA-Phe
  3426. Escherichia coli O23:H16 tRNA-Phe
  3427. Escherichia coli O23:H43 tRNA-Phe
  3428. Escherichia coli O23:H8 tRNA-Phe
  3429. Escherichia coli O24:H4 tRNA-Phe
  3430. Escherichia coli O24 tRNA-Phe
  3431. Escherichia coli O2,50:H19 tRNA-Phe
  3432. Escherichia coli O2,50:H32 tRNA-Phe
  3433. Escherichia coli O25b:H4-ST131 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3434. Escherichia coli O25b:H4 tRNA-Phe
  3435. Escherichia coli O25:H10 tRNA-Phe
  3436. Escherichia coli O25:H18 tRNA-Phe
  3437. Escherichia coli O25:H19 tRNA-Phe
  3438. Escherichia coli O25:H1 tRNA-Phe
  3439. Escherichia coli O25:H30 tRNA-Phe
  3440. Escherichia coli O25:H4 tRNA-Phe
  3441. Escherichia coli O25:NM str. E2539C1 tRNA-Phe
  3442. Escherichia coli O25 str. E39a tRNA-Phe
  3443. Escherichia coli O25 tRNA-Phe
  3444. Escherichia coli O26:H10 tRNA-Phe
  3445. Escherichia coli O26:H11 str. 05-3646 tRNA-Phe
  3446. Escherichia coli O26:H11 str. 11368 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3447. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Phe
  3448. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Phe
  3449. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Phe
  3450. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Phe
  3451. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Phe
  3452. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Phe
  3453. Escherichia coli O26:H11 str. CFSAN001629 tRNA-Phe
  3454. Escherichia coli O26:H11 str. CVM10021 tRNA-Phe
  3455. Escherichia coli O26:H11 str. CVM10026 tRNA-Phe
  3456. Escherichia coli O26:H11 str. CVM10030 tRNA-Phe
  3457. Escherichia coli O26:H11 str. CVM10224 tRNA-Phe
  3458. Escherichia coli O26:H11 str. CVM9942 tRNA-Phe
  3459. Escherichia coli O26:H11 str. CVM9952 tRNA-Phe
  3460. Escherichia coli O26:H11 tRNA-Phe
  3461. Escherichia coli O26:H18 tRNA-Phe
  3462. Escherichia coli O26:H32 tRNA-Phe
  3463. Escherichia coli O26:H40 tRNA-Phe
  3464. Escherichia coli O26:NM str. 2010C-4788 tRNA-Phe
  3465. Escherichia coli O26 str. RM10386 tRNA-Phe
  3466. Escherichia coli O26 str. RM8426 tRNA-Phe
  3467. Escherichia coli O26 tRNA-Phe
  3468. Escherichia coli O27:H14 tRNA-Phe
  3469. Escherichia coli O28/42:H37 tRNA-Phe
  3470. Escherichia coli O28ac, 42:H25 tRNA-Phe
  3471. Escherichia coli O28ac/42:H25 tRNA-Phe
  3472. Escherichia coli O28ac,42:H32 tRNA-Phe
  3473. Escherichia coli O28ac/42:H37 tRNA-Phe
  3474. Escherichia coli O28ac,42:H7 tRNA-Phe
  3475. Escherichia coli O28ac:NM str. 02-3404 tRNA-Phe
  3476. Escherichia coli O28ac tRNA-Phe
  3477. Escherichia coli O29:H8 tRNA-Phe
  3478. Escherichia coli O2:H14 tRNA-Phe
  3479. Escherichia coli O2:H16 tRNA-Phe
  3480. Escherichia coli O2:H1 tRNA-Phe
  3481. Escherichia coli O2:H4 tRNA-Phe
  3482. Escherichia coli O2:H6 tRNA-Phe
  3483. Escherichia coli O2:K1:H4 tRNA-Phe
  3484. Escherichia coli O2:K1:H5 tRNA-Phe
  3485. Escherichia coli O2:K1:H7 tRNA-Phe
  3486. Escherichia coli O2:K2:H1 tRNA-Phe
  3487. Escherichia coli O2/O50:H1 tRNA-Phe
  3488. Escherichia coli O2/O50:H5 tRNA-Phe
  3489. Escherichia coli O2 tRNA-Phe
  3490. Escherichia coli O30,9:H25 tRNA-Phe
  3491. Escherichia coli O30/O9:H25 tRNA-Phe
  3492. Escherichia coli O32:H37 str. P4 tRNA-Phe
  3493. Escherichia coli O32/O8:H8 tRNA-Phe
  3494. Escherichia coli O32 tRNA-Phe
  3495. Escherichia coli O33:H18 tRNA-Phe
  3496. Escherichia coli O33:H4 tRNA-Phe
  3497. Escherichia coli O33 tRNA-Phe
  3498. Escherichia coli O35:H10 tRNA-Phe
  3499. Escherichia coli O35:H4 tRNA-Phe
  3500. Escherichia coli O35 tRNA-Phe
  3501. Escherichia coli O36:H14 tRNA-Phe
  3502. Escherichia coli O36:H51 tRNA-Phe
  3503. Escherichia coli O36:H5 tRNA-Phe
  3504. Escherichia coli O36:H9 tRNA-Phe
  3505. Escherichia coli O36 tRNA-Phe
  3506. Escherichia coli O38:H26 tRNA-Phe
  3507. Escherichia coli O38:H39 tRNA-Phe
  3508. Escherichia coli O39:H21 tRNA-Phe
  3509. Escherichia coli O39:H4 tRNA-Phe
  3510. Escherichia coli O3:H2 tRNA-Phe
  3511. Escherichia coli O3:H7 tRNA-Phe
  3512. Escherichia coli O3:H9 tRNA-Phe
  3513. Escherichia coli O3 tRNA-Phe
  3514. Escherichia coli O409 tRNA-Phe
  3515. Escherichia coli O40:H32 tRNA-Phe
  3516. Escherichia coli O40 tRNA-Phe
  3517. Escherichia coli O41:H11 tRNA-Phe
  3518. Escherichia coli O41:H45 tRNA-Phe
  3519. Escherichia coli O43:H14 tRNA-Phe
  3520. Escherichia coli O43:H2 tRNA-Phe
  3521. Escherichia coli O43 str. RM10042 tRNA-Phe
  3522. Escherichia coli O43 tRNA-Phe
  3523. Escherichia coli O45:H11 tRNA-Phe
  3524. Escherichia coli O45:H12 tRNA-Phe
  3525. Escherichia coli O45:H16 tRNA-Phe
  3526. Escherichia coli O45:H2 str. 01-3147 tRNA-Phe
  3527. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Phe
  3528. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Phe
  3529. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Phe
  3530. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Phe
  3531. Escherichia coli O45:H2 tRNA-Phe
  3532. Escherichia coli O45:H30 tRNA-Phe
  3533. Escherichia coli O45:H45 tRNA-Phe
  3534. Escherichia coli O45:H4 tRNA-Phe
  3535. Escherichia coli O45:H7 tRNA-Phe
  3536. Escherichia coli O45:H8 tRNA-Phe
  3537. Escherichia coli O45 tRNA-Phe
  3538. Escherichia coli O48:H34 tRNA-Phe
  3539. Escherichia coli O49:H6 tRNA-Phe
  3540. Escherichia coli O49:H9 tRNA-Phe
  3541. Escherichia coli O4:H1 tRNA-Phe
  3542. Escherichia coli O4:H2 tRNA-Phe
  3543. Escherichia coli O4:H45 tRNA-Phe
  3544. Escherichia coli O4:H5 tRNA-Phe
  3545. Escherichia coli O4 tRNA-Phe
  3546. Escherichia coli O51:H10 tRNA-Phe
  3547. Escherichia coli O51:H20 tRNA-Phe
  3548. Escherichia coli O51:H21 tRNA-Phe
  3549. Escherichia coli O51:H4 tRNA-Phe
  3550. Escherichia coli O51:H51 tRNA-Phe
  3551. Escherichia coli O53:H10 tRNA-Phe
  3552. Escherichia coli O53:H51 tRNA-Phe
  3553. Escherichia coli O53 tRNA-Phe
  3554. Escherichia coli O54:H2 tRNA-Phe
  3555. Escherichia coli O54:H45 tRNA-Phe
  3556. Escherichia coli O54 tRNA-Phe
  3557. Escherichia coli O55:H7 str. 06-3555 tRNA-Phe
  3558. Escherichia coli O55:H7 str. 3256-97 tRNA-Phe
  3559. Escherichia coli O55:H7 str. CB9615 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3560. Escherichia coli O55:H7 str. RM12579 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3561. Escherichia coli O55:H7 str. TB182A tRNA-Phe
  3562. Escherichia coli O55:H7 str. USDA 5905 tRNA-Phe
  3563. Escherichia coli O55:H7 tRNA-Phe
  3564. Escherichia coli O55 tRNA-Phe
  3565. Escherichia coli O57:H16 tRNA-Phe
  3566. Escherichia coli O59:H20 tRNA-Phe
  3567. Escherichia coli O5:H11 tRNA-Phe
  3568. Escherichia coli O5:H32 tRNA-Phe
  3569. Escherichia coli O5:H9 tRNA-Phe
  3570. Escherichia coli O5:K4(L):H4 str. ATCC 23502 tRNA-Phe-GAA
  3571. Escherichia coli O5 tRNA-Phe
  3572. Escherichia coli O6,162:H7,49 tRNA-Phe
  3573. Escherichia coli O64:H25 tRNA-Phe
  3574. Escherichia coli O65:H11 tRNA-Phe
  3575. Escherichia coli O65 tRNA-Phe
  3576. Escherichia coli O66:H2 tRNA-Phe
  3577. Escherichia coli O66:H5 tRNA-Phe
  3578. Escherichia coli O68:H12 tRNA-Phe
  3579. Escherichia coli O68 tRNA-Phe
  3580. Escherichia coli O69:H11 str. 06-3325 tRNA-Phe
  3581. Escherichia coli O69:H11 str. 07-3763 tRNA-Phe
  3582. Escherichia coli O69:H11 str. 07-4281 tRNA-Phe
  3583. Escherichia coli O69:H11 str. 08-4661 tRNA-Phe
  3584. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Phe
  3585. Escherichia coli O6:H10 tRNA-Phe
  3586. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Phe
  3587. Escherichia coli O6:H16 str. 99-3165 tRNA-Phe
  3588. Escherichia coli O6:H16 str. F5656C1 tRNA-Phe
  3589. Escherichia coli O6:H16 tRNA-Phe
  3590. Escherichia coli O6:H1 tRNA-Phe
  3591. Escherichia coli O6:H31 tRNA-Phe
  3592. Escherichia coli O6:H34 tRNA-Phe
  3593. Escherichia coli O6:H49 tRNA-Phe
  3594. Escherichia coli O6:K2:H1 tRNA-Phe
  3595. Escherichia coli O6 str. Bi7458-41 tRNA-Phe
  3596. Escherichia coli O6 tRNA-Phe
  3597. Escherichia coli O70:H10 tRNA-Phe
  3598. Escherichia coli O70:H25 tRNA-Phe
  3599. Escherichia coli O70:H38 tRNA-Phe
  3600. Escherichia coli O71:H6 tRNA-Phe
  3601. Escherichia coli O73,17,77:H31 tRNA-Phe
  3602. Escherichia coli O73 tRNA-Phe
  3603. Escherichia coli O74:H28 tRNA-Phe
  3604. Escherichia coli O74:H39 tRNA-Phe
  3605. Escherichia coli O74:H8 tRNA-Phe
  3606. Escherichia coli O74 tRNA-Phe
  3607. Escherichia coli O75:H8 tRNA-Phe
  3608. Escherichia coli O75:H9 tRNA-Phe
  3609. Escherichia coli O75 tRNA-Phe
  3610. Escherichia coli O76:H32 tRNA-Phe
  3611. Escherichia coli O76:H7 tRNA-Phe
  3612. Escherichia coli O76 tRNA-Phe
  3613. Escherichia coli O78:H12 str. 00-3279 tRNA-Phe
  3614. Escherichia coli O78:H4 tRNA-Phe
  3615. Escherichia coli O78:H51 tRNA-Phe
  3616. Escherichia coli O78 tRNA-Phe
  3617. Escherichia coli O79:H21 tRNA-Phe
  3618. Escherichia coli O79:H28 tRNA-Phe
  3619. Escherichia coli O79:H40 tRNA-Phe
  3620. Escherichia coli O79:H51 tRNA-Phe
  3621. Escherichia coli O79:H7 str. 06-3501 tRNA-Phe
  3622. Escherichia coli O79 tRNA-Phe
  3623. Escherichia coli O7:H10 tRNA-Phe
  3624. Escherichia coli O7:H15 tRNA-Phe
  3625. Escherichia coli O7:H18 tRNA-Phe
  3626. Escherichia coli O7:H4 tRNA-Phe
  3627. Escherichia coli O7:H6 tRNA-Phe
  3628. Escherichia coli O7:H7 tRNA-Phe
  3629. Escherichia coli O7:K1 str. CE10 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3630. Escherichia coli O7 tRNA-Phe
  3631. Escherichia coli O80:H19 tRNA-Phe
  3632. Escherichia coli O80:H26 tRNA-Phe
  3633. Escherichia coli O80:H45 tRNA-Phe
  3634. Escherichia coli O8,13,108,129,135:H11,20 tRNA-Phe
  3635. Escherichia coli O8,155:H11 tRNA-Phe
  3636. Escherichia coli O8,155:H20 tRNA-Phe
  3637. Escherichia coli O8,160:H51 tRNA-Phe
  3638. Escherichia coli O81:H27 tRNA-Phe
  3639. Escherichia coli O81:H39 tRNA-Phe
  3640. Escherichia coli O81:NM str. 02-3012 tRNA-Phe
  3641. Escherichia coli O82,121:H8 tRNA-Phe
  3642. Escherichia coli O82:H8 tRNA-Phe
  3643. Escherichia coli O82 tRNA-Phe
  3644. Escherichia coli O83:H15 tRNA-Phe
  3645. Escherichia coli O83:H1 str. NRG 857C tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3646. Escherichia coli O83:H1 tRNA-Phe
  3647. Escherichia coli O83:H28 tRNA-Phe
  3648. Escherichia coli O83:H31 tRNA-Phe
  3649. Escherichia coli O83:H32 tRNA-Phe
  3650. Escherichia coli O83:H42 tRNA-Phe
  3651. Escherichia coli O83:H7 tRNA-Phe
  3652. Escherichia coli O83 tRNA-Phe
  3653. Escherichia coli O83w tRNA-Phe
  3654. Escherichia coli O84:H14 tRNA-Phe
  3655. Escherichia coli O84:H25 tRNA-Phe
  3656. Escherichia coli O84:H51 tRNA-Phe
  3657. Escherichia coli O84:H7 tRNA-Phe
  3658. Escherichia coli O85:H18 tRNA-Phe
  3659. Escherichia coli O85:H1 tRNA-Phe
  3660. Escherichia coli O85:H32 tRNA-Phe
  3661. Escherichia coli O86:H12 tRNA-Phe
  3662. Escherichia coli O86:H18 tRNA-Phe
  3663. Escherichia coli O86:H34 str. 99-3124 tRNA-Phe
  3664. Escherichia coli O86:H51 tRNA-Phe
  3665. Escherichia coli O86:H8 tRNA-Phe
  3666. Escherichia coli O86 tRNA-Phe
  3667. Escherichia coli O87:H16 tRNA-Phe
  3668. Escherichia coli O87:H39 tRNA-Phe
  3669. Escherichia coli O88:H1 tRNA-Phe
  3670. Escherichia coli O88:H21 tRNA-Phe
  3671. Escherichia coli O88:H25 tRNA-Phe
  3672. Escherichia coli O88:H31 tRNA-Phe
  3673. Escherichia coli O88:H38 tRNA-Phe
  3674. Escherichia coli O88:H4 tRNA-Phe
  3675. Escherichia coli O88:H8 tRNA-Phe
  3676. Escherichia coli O88 tRNA-Phe
  3677. Escherichia coli O89m:H10 tRNA-Phe
  3678. Escherichia coli O89m:H9 tRNA-Phe
  3679. Escherichia coli O8:H10 tRNA-Phe
  3680. Escherichia coli O8:H11 tRNA-Phe
  3681. Escherichia coli O8:H16 tRNA-Phe
  3682. Escherichia coli O8:H19 tRNA-Phe
  3683. Escherichia coli O8:H20 tRNA-Phe
  3684. Escherichia coli O8:H21 tRNA-Phe
  3685. Escherichia coli O8:H25 tRNA-Phe
  3686. Escherichia coli O8:H28 tRNA-Phe
  3687. Escherichia coli O8:H30 tRNA-Phe
  3688. Escherichia coli O8:H31 tRNA-Phe
  3689. Escherichia coli O8:H34 tRNA-Phe
  3690. Escherichia coli O8:H36 tRNA-Phe
  3691. Escherichia coli O8:H49 tRNA-Phe
  3692. Escherichia coli O8:H4 tRNA-Phe
  3693. Escherichia coli O8:H5 tRNA-Phe
  3694. Escherichia coli O8:H7 tRNA-Phe
  3695. Escherichia coli O8:H8 tRNA-Phe
  3696. Escherichia coli O8:H9 tRNA-Phe
  3697. Escherichia coli O8 tRNA-Phe
  3698. Escherichia coli O91:H14 str. 06-3691 tRNA-Phe
  3699. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Phe
  3700. Escherichia coli O91:H14 tRNA-Phe
  3701. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Phe
  3702. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Phe
  3703. Escherichia coli O91:H21 tRNA-Phe
  3704. Escherichia coli O91:H23 tRNA-Phe
  3705. Escherichia coli O91:H28 tRNA-Phe
  3706. Escherichia coli O91:NM str. 2009C-3745 tRNA-Phe
  3707. Escherichia coli O91 str. RM7190 tRNA-Phe
  3708. Escherichia coli O91 tRNA-Phe
  3709. Escherichia coli O92:H33 tRNA-Phe
  3710. Escherichia coli O9,30:H25 tRNA-Phe
  3711. Escherichia coli O93:H19 tRNA-Phe
  3712. Escherichia coli O93:H21 tRNA-Phe
  3713. Escherichia coli O96 tRNA-Phe
  3714. Escherichia coli O98:H49 tRNA-Phe
  3715. Escherichia coli O9,9a:H10 tRNA-Phe
  3716. Escherichia coli O9,9a:H21 tRNA-Phe
  3717. Escherichia coli O9,9a:H30 tRNA-Phe
  3718. Escherichia coli O9,9a:H4 tRNA-Phe
  3719. Escherichia coli O9,9a:H9 tRNA-Phe
  3720. Escherichia coli O9,9a tRNA-Phe
  3721. Escherichia coli O99:H27 tRNA-Phe
  3722. Escherichia coli O99:H33 tRNA-Phe
  3723. Escherichia coli O99:H4 tRNA-Phe
  3724. Escherichia coli O99:H6 tRNA-Phe
  3725. Escherichia coli O9a/9:H30 tRNA-Phe
  3726. Escherichia coli O9a:H30 tRNA-Phe
  3727. Escherichia coli O9a:H4 tRNA-Phe
  3728. Escherichia coli O9:H10 tRNA-Phe
  3729. Escherichia coli O9:H16 tRNA-Phe
  3730. Escherichia coli O9:H25 tRNA-Phe
  3731. Escherichia coli O9:H37 tRNA-Phe
  3732. Escherichia coli O9:H4 tRNA-Phe
  3733. Escherichia coli O9:H9 tRNA-Phe
  3734. Escherichia coli O9 tRNA-Phe
  3735. Escherichia coli OK1180 tRNA-Phe
  3736. Escherichia coli OK1357 tRNA-Phe
  3737. Escherichia coli ONT:H33 str. C48/93 tRNA-Phe
  3738. Escherichia coli OP50 tRNA-Phe
  3739. Escherichia coli Ou:H16 tRNA-Phe
  3740. Escherichia coli Ou:H21 tRNA-Phe
  3741. Escherichia coli Ou:H26 tRNA-Phe
  3742. Escherichia coli Ou:H6 tRNA-Phe
  3743. Escherichia coli Ou:H7 tRNA-Phe
  3744. Escherichia coli Ou:H8 tRNA-Phe
  3745. Escherichia coli OX01:H8 tRNA-Phe
  3746. Escherichia coli OX21:H7 tRNA-Phe
  3747. Escherichia coli OX25:H28 tRNA-Phe
  3748. Escherichia coli OX25:H6 tRNA-Phe
  3749. Escherichia coli OX25 tRNA-Phe
  3750. Escherichia coli OX38:H47 tRNA-Phe
  3751. Escherichia coli P0298942.10 tRNA-Phe
  3752. Escherichia coli P0298942.11 tRNA-Phe
  3753. Escherichia coli P0298942.12 tRNA-Phe
  3754. Escherichia coli P0298942.14 tRNA-Phe
  3755. Escherichia coli P0298942.15 tRNA-Phe
  3756. Escherichia coli P0298942.1 tRNA-Phe
  3757. Escherichia coli P0298942.2 tRNA-Phe
  3758. Escherichia coli P0298942.3 tRNA-Phe
  3759. Escherichia coli P0298942.4 tRNA-Phe
  3760. Escherichia coli P0298942.6 tRNA-Phe
  3761. Escherichia coli P0298942.7 tRNA-Phe
  3762. Escherichia coli P0298942.8 tRNA-Phe
  3763. Escherichia coli P0298942.9 tRNA-Phe
  3764. Escherichia coli P0299438.10 tRNA-Phe
  3765. Escherichia coli P0299438.11 tRNA-Phe
  3766. Escherichia coli P0299438.2 tRNA-Phe
  3767. Escherichia coli P0299438.3 tRNA-Phe
  3768. Escherichia coli P0299438.4 tRNA-Phe
  3769. Escherichia coli P0299438.5 tRNA-Phe
  3770. Escherichia coli P0299438.6 tRNA-Phe
  3771. Escherichia coli P0299438.7 tRNA-Phe
  3772. Escherichia coli P0299438.8 tRNA-Phe
  3773. Escherichia coli P0299438.9 tRNA-Phe
  3774. Escherichia coli P0299483.1 tRNA-Phe
  3775. Escherichia coli P0299483.2 tRNA-Phe
  3776. Escherichia coli P0299483.3 tRNA-Phe
  3777. Escherichia coli P02997067.6 tRNA-Phe
  3778. Escherichia coli P0299917.10 tRNA-Phe
  3779. Escherichia coli P0299917.1 tRNA-Phe
  3780. Escherichia coli P0299917.2 tRNA-Phe
  3781. Escherichia coli P0299917.3 tRNA-Phe
  3782. Escherichia coli P0299917.4 tRNA-Phe
  3783. Escherichia coli P0299917.5 tRNA-Phe
  3784. Escherichia coli P0299917.6 tRNA-Phe
  3785. Escherichia coli P0299917.7 tRNA-Phe
  3786. Escherichia coli P0299917.8 tRNA-Phe
  3787. Escherichia coli P0299917.9 tRNA-Phe
  3788. Escherichia coli P0301867.11 tRNA-Phe
  3789. Escherichia coli P0301867.13 tRNA-Phe
  3790. Escherichia coli P0301867.1 tRNA-Phe
  3791. Escherichia coli P0301867.2 tRNA-Phe
  3792. Escherichia coli P0301867.3 tRNA-Phe
  3793. Escherichia coli P0301867.4 tRNA-Phe
  3794. Escherichia coli P0301867.5 tRNA-Phe
  3795. Escherichia coli P0301867.7 tRNA-Phe
  3796. Escherichia coli P0301867.8 tRNA-Phe
  3797. Escherichia coli P0301904.3 tRNA-Phe
  3798. Escherichia coli P0302293.10 tRNA-Phe
  3799. Escherichia coli P0302293.2 tRNA-Phe
  3800. Escherichia coli P0302293.3 tRNA-Phe
  3801. Escherichia coli P0302293.4 tRNA-Phe
  3802. Escherichia coli P0302293.6 tRNA-Phe
  3803. Escherichia coli P0302293.7 tRNA-Phe
  3804. Escherichia coli P0302293.8 tRNA-Phe
  3805. Escherichia coli P0302293.9 tRNA-Phe
  3806. Escherichia coli P0302308.10 tRNA-Phe
  3807. Escherichia coli P0302308.11 tRNA-Phe
  3808. Escherichia coli P0302308.12 tRNA-Phe
  3809. Escherichia coli P0302308.13 tRNA-Phe
  3810. Escherichia coli P0302308.14 tRNA-Phe
  3811. Escherichia coli P0302308.1 tRNA-Phe
  3812. Escherichia coli P0302308.2 tRNA-Phe
  3813. Escherichia coli P0302308.3 tRNA-Phe
  3814. Escherichia coli P0302308.4 tRNA-Phe
  3815. Escherichia coli P0302308.5 tRNA-Phe
  3816. Escherichia coli P0304777.10 tRNA-Phe
  3817. Escherichia coli P0304777.11 tRNA-Phe
  3818. Escherichia coli P0304777.12 tRNA-Phe
  3819. Escherichia coli P0304777.13 tRNA-Phe
  3820. Escherichia coli P0304777.14 tRNA-Phe
  3821. Escherichia coli P0304777.15 tRNA-Phe
  3822. Escherichia coli P0304777.1 tRNA-Phe
  3823. Escherichia coli P0304777.2 tRNA-Phe
  3824. Escherichia coli P0304777.3 tRNA-Phe
  3825. Escherichia coli P0304777.4 tRNA-Phe
  3826. Escherichia coli P0304777.5 tRNA-Phe
  3827. Escherichia coli P0304777.7 tRNA-Phe
  3828. Escherichia coli P0304777.8 tRNA-Phe
  3829. Escherichia coli P0304777.9 tRNA-Phe
  3830. Escherichia coli P0304799.3 tRNA-Phe
  3831. Escherichia coli P0304816.10 tRNA-Phe
  3832. Escherichia coli P0304816.11 tRNA-Phe
  3833. Escherichia coli P0304816.12 tRNA-Phe
  3834. Escherichia coli P0304816.13 tRNA-Phe
  3835. Escherichia coli P0304816.14 tRNA-Phe
  3836. Escherichia coli P0304816.15 tRNA-Phe
  3837. Escherichia coli P0304816.1 tRNA-Phe
  3838. Escherichia coli P0304816.2 tRNA-Phe
  3839. Escherichia coli P0304816.3 tRNA-Phe
  3840. Escherichia coli P0304816.4 tRNA-Phe
  3841. Escherichia coli P0304816.5 tRNA-Phe
  3842. Escherichia coli P0304816.6 tRNA-Phe
  3843. Escherichia coli P0304816.7 tRNA-Phe
  3844. Escherichia coli P0304816.8 tRNA-Phe
  3845. Escherichia coli P0304816.9 tRNA-Phe
  3846. Escherichia coli P0305260.10 tRNA-Phe
  3847. Escherichia coli P0305260.11 tRNA-Phe
  3848. Escherichia coli P0305260.12 tRNA-Phe
  3849. Escherichia coli P0305260.13 tRNA-Phe
  3850. Escherichia coli P0305260.15 tRNA-Phe
  3851. Escherichia coli P0305260.1 tRNA-Phe
  3852. Escherichia coli P0305260.2 tRNA-Phe
  3853. Escherichia coli P0305260.3 tRNA-Phe
  3854. Escherichia coli P0305260.4 tRNA-Phe
  3855. Escherichia coli P0305260.5 tRNA-Phe
  3856. Escherichia coli P0305260.6 tRNA-Phe
  3857. Escherichia coli P0305260.7 tRNA-Phe
  3858. Escherichia coli P0305260.8 tRNA-Phe
  3859. Escherichia coli P0305260.9 tRNA-Phe
  3860. Escherichia coli p0305293.10 tRNA-Phe
  3861. Escherichia coli p0305293.11 tRNA-Phe
  3862. Escherichia coli p0305293.12 tRNA-Phe
  3863. Escherichia coli p0305293.13 tRNA-Phe
  3864. Escherichia coli p0305293.14 tRNA-Phe
  3865. Escherichia coli p0305293.15 tRNA-Phe
  3866. Escherichia coli p0305293.1 tRNA-Phe
  3867. Escherichia coli p0305293.2 tRNA-Phe
  3868. Escherichia coli p0305293.3 tRNA-Phe
  3869. Escherichia coli p0305293.4 tRNA-Phe
  3870. Escherichia coli p0305293.5 tRNA-Phe
  3871. Escherichia coli p0305293.6 tRNA-Phe
  3872. Escherichia coli p0305293.7 tRNA-Phe
  3873. Escherichia coli p0305293.8 tRNA-Phe
  3874. Escherichia coli p0305293.9 tRNA-Phe
  3875. Escherichia coli P12b tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3876. Escherichia coli P4-96 tRNA-Phe
  3877. Escherichia coli P4-NR tRNA-Phe
  3878. Escherichia coli PA10 tRNA-Phe
  3879. Escherichia coli PA11 tRNA-Phe
  3880. Escherichia coli PA13 tRNA-Phe
  3881. Escherichia coli PA14 tRNA-Phe
  3882. Escherichia coli PA15 tRNA-Phe
  3883. Escherichia coli PA19 tRNA-Phe
  3884. Escherichia coli PA22 tRNA-Phe
  3885. Escherichia coli PA23 tRNA-Phe
  3886. Escherichia coli PA24 tRNA-Phe
  3887. Escherichia coli PA25 tRNA-Phe
  3888. Escherichia coli PA28 tRNA-Phe
  3889. Escherichia coli PA2 tRNA-Phe
  3890. Escherichia coli PA31 tRNA-Phe
  3891. Escherichia coli PA32 tRNA-Phe
  3892. Escherichia coli PA33 tRNA-Phe
  3893. Escherichia coli PA34 tRNA-Phe
  3894. Escherichia coli PA35 tRNA-Phe
  3895. Escherichia coli PA38 tRNA-Phe
  3896. Escherichia coli PA39 tRNA-Phe
  3897. Escherichia coli PA3 tRNA-Phe
  3898. Escherichia coli PA40 tRNA-Phe
  3899. Escherichia coli PA41 tRNA-Phe
  3900. Escherichia coli PA42 tRNA-Phe
  3901. Escherichia coli PA45 tRNA-Phe
  3902. Escherichia coli PA47 tRNA-Phe
  3903. Escherichia coli PA48 tRNA-Phe
  3904. Escherichia coli PA49 tRNA-Phe
  3905. Escherichia coli PA4 tRNA-Phe
  3906. Escherichia coli PA5 tRNA-Phe
  3907. Escherichia coli PA7 tRNA-Phe
  3908. Escherichia coli PA8 tRNA-Phe
  3909. Escherichia coli PA9 tRNA-Phe
  3910. Escherichia coli PCN009 tRNA-Phe
  3911. Escherichia coli PCN061 tRNA-Phe
  3912. Escherichia coli PCN079 tRNA-Phe
  3913. Escherichia coli PMV-1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3914. Escherichia coli QU090 tRNA-Phe
  3915. Escherichia coli R424 tRNA-Phe
  3916. Escherichia coli R527 tRNA-Phe
  3917. Escherichia coli RDEC-1 (10f) tRNA-Phe
  3918. Escherichia coli RN587/1 tRNA-Phe
  3919. Escherichia coli RS218 tRNA-Phe
  3920. Escherichia coli S17 tRNA-Phe
  3921. Escherichia coli S88 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3922. Escherichia coli SaT040 tRNA-Phe
  3923. Escherichia coli SaT049 tRNA-Phe
  3924. Escherichia coli SaT142 tRNA-Phe
  3925. Escherichia coli SaT158 tRNA-Phe
  3926. Escherichia coli SCI-07 tRNA-Phe
  3927. Escherichia coli SE11 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3928. Escherichia coli SE15 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3929. Escherichia coli SEPT362 tRNA-Phe
  3930. Escherichia coli SHECO001 tRNA-Phe
  3931. Escherichia coli SHECO002 tRNA-Phe
  3932. Escherichia coli SHECO003 tRNA-Phe
  3933. Escherichia coli SMS-3-5 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3934. Escherichia coli STEC_7v tRNA-Phe
  3935. Escherichia coli STEC_94C tRNA-Phe
  3936. Escherichia coli O91:H21 str. B2F1 tRNA-Phe
  3937. Escherichia coli STEC_C165-02 tRNA-Phe
  3938. Escherichia coli STEC_DG131-3 tRNA-Phe
  3939. Escherichia coli STEC_EH250 tRNA-Phe
  3940. Escherichia coli STEC_MHI813 tRNA-Phe
  3941. Escherichia coli STEC_O31 tRNA-Phe
  3942. Escherichia coli STEC_S1191 tRNA-Phe
  3943. Escherichia coli str. 'clone D i14' tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3944. Escherichia coli str. 'clone D i2' tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3945. Escherichia coli str. K-12 substr. DH10B tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3946. Escherichia coli str. K-12 substr. MC4100 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3947. Escherichia coli str. K-12 substr. MDS42 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3948. Escherichia coli str. K-12 substr. MG1655star tRNA-Phe
  3949. Escherichia coli str. K-12 substr. MG1655 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3950. Escherichia coli str. K-12 substr. W3110 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3951. Escherichia coli str. Sanji tRNA-Phe
  3952. Escherichia coli SWW33 tRNA-Phe
  3953. Escherichia coli T1282_01 tRNA-Phe
  3954. Escherichia coli T1840_97 tRNA-Phe
  3955. Escherichia coli T234_00 tRNA-Phe
  3956. Escherichia coli T426 tRNA-Phe
  3957. Escherichia coli TA007 tRNA-Phe
  3958. Escherichia coli TA008 tRNA-Phe
  3959. Escherichia coli TA014 tRNA-Phe
  3960. Escherichia coli TA054 tRNA-Phe
  3961. Escherichia coli TA124 tRNA-Phe
  3962. Escherichia coli TA143 tRNA-Phe
  3963. Escherichia coli TA144 tRNA-Phe
  3964. Escherichia coli TA206 tRNA-Phe
  3965. Escherichia coli TA249 tRNA-Phe
  3966. Escherichia coli TA255 tRNA-Phe
  3967. Escherichia coli TA271 tRNA-Phe
  3968. Escherichia coli TA280 tRNA-Phe
  3969. Escherichia coli TA447 tRNA-Phe
  3970. Escherichia coli TA464 tRNA-Phe
  3971. Escherichia coli ThroopD tRNA-Phe
  3972. Escherichia coli tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  3973. Escherichia coli TT12B tRNA-Phe
  3974. Escherichia coli TW00353 tRNA-Phe
  3975. Escherichia coli TW06591 tRNA-Phe
  3976. Escherichia coli TW07509 tRNA-Phe
  3977. Escherichia coli TW07793 tRNA-Phe
  3978. Escherichia coli TW07945 tRNA-Phe
  3979. Escherichia coli TW09098 tRNA-Phe
  3980. Escherichia coli TW09109 tRNA-Phe
  3981. Escherichia coli TW09195 tRNA-Phe
  3982. Escherichia coli TW10119 tRNA-Phe
  3983. Escherichia coli TW10246 tRNA-Phe
  3984. Escherichia coli TW10509 tRNA-Phe
  3985. Escherichia coli TW11039 tRNA-Phe
  3986. Escherichia coli TW14301 tRNA-Phe
  3987. Escherichia coli TW14425 tRNA-Phe
  3988. Escherichia coli TW15901 tRNA-Phe
  3989. Escherichia coli Tx1686 tRNA-Phe
  3990. Escherichia coli TX1999 tRNA-Phe
  3991. Escherichia coli Tx3800 tRNA-Phe
  3992. Escherichia coli U004 tRNA-Phe
  3993. Escherichia coli U024 tRNA-Phe
  3994. Escherichia coli U054 tRNA-Phe
  3995. Escherichia coli UCI 51 tRNA-Phe
  3996. Escherichia coli UCI 52 tRNA-Phe
  3997. Escherichia coli UCI 53 tRNA-Phe
  3998. Escherichia coli UCI 57 tRNA-Phe
  3999. Escherichia coli UCI 58 tRNA-Phe
  4000. Escherichia coli UCI 65 tRNA-Phe
  4001. Escherichia coli UCI 66 tRNA-Phe
  4002. Escherichia coli UM146 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4003. Escherichia coli UMEA 3014-1 tRNA-Phe
  4004. Escherichia coli UMEA 3022-1 tRNA-Phe
  4005. Escherichia coli UMEA 3033-1 tRNA-Phe
  4006. Escherichia coli UMEA 3041-1 tRNA-Phe
  4007. Escherichia coli UMEA 3052-1 tRNA-Phe
  4008. Escherichia coli UMEA 3053-1 tRNA-Phe
  4009. Escherichia coli UMEA 3065-1 tRNA-Phe
  4010. Escherichia coli UMEA 3087-1 tRNA-Phe
  4011. Escherichia coli UMEA 3088-1 tRNA-Phe
  4012. Escherichia coli UMEA 3097-1 tRNA-Phe
  4013. Escherichia coli UMEA 3108-1 tRNA-Phe
  4014. Escherichia coli UMEA 3113-1 tRNA-Phe
  4015. Escherichia coli UMEA 3117-1 tRNA-Phe
  4016. Escherichia coli UMEA 3121-1 tRNA-Phe
  4017. Escherichia coli UMEA 3122-1 tRNA-Phe
  4018. Escherichia coli UMEA 3124-1 tRNA-Phe
  4019. Escherichia coli UMEA 3139-1 tRNA-Phe
  4020. Escherichia coli UMEA 3140-1 tRNA-Phe
  4021. Escherichia coli UMEA 3144-1 tRNA-Phe
  4022. Escherichia coli UMEA 3148-1 tRNA-Phe
  4023. Escherichia coli UMEA 3150-1 tRNA-Phe
  4024. Escherichia coli UMEA 3151-1 tRNA-Phe
  4025. Escherichia coli UMEA 3152-1 tRNA-Phe
  4026. Escherichia coli UMEA 3155-1 tRNA-Phe
  4027. Escherichia coli UMEA 3159-1 tRNA-Phe
  4028. Escherichia coli UMEA 3160-1 tRNA-Phe
  4029. Escherichia coli UMEA 3161-1 tRNA-Phe
  4030. Escherichia coli UMEA 3162-1 tRNA-Phe
  4031. Escherichia coli UMEA 3163-1 tRNA-Phe
  4032. Escherichia coli UMEA 3172-1 tRNA-Phe
  4033. Escherichia coli UMEA 3173-1 tRNA-Phe
  4034. Escherichia coli UMEA 3174-1 tRNA-Phe
  4035. Escherichia coli UMEA 3175-1 tRNA-Phe
  4036. Escherichia coli UMEA 3176-1 tRNA-Phe
  4037. Escherichia coli UMEA 3178-1 tRNA-Phe
  4038. Escherichia coli UMEA 3180-1 tRNA-Phe
  4039. Escherichia coli UMEA 3185-1 tRNA-Phe
  4040. Escherichia coli UMEA 3190-1 tRNA-Phe
  4041. Escherichia coli UMEA 3193-1 tRNA-Phe
  4042. Escherichia coli UMEA 3199-1 tRNA-Phe
  4043. Escherichia coli UMEA 3200-1 tRNA-Phe
  4044. Escherichia coli UMEA 3201-1 tRNA-Phe
  4045. Escherichia coli UMEA 3203-1 tRNA-Phe
  4046. Escherichia coli UMEA 3206-1 tRNA-Phe
  4047. Escherichia coli UMEA 3208-1 tRNA-Phe
  4048. Escherichia coli UMEA 3212-1 tRNA-Phe
  4049. Escherichia coli UMEA 3215-1 tRNA-Phe
  4050. Escherichia coli UMEA 3216-1 tRNA-Phe
  4051. Escherichia coli UMEA 3217-1 tRNA-Phe
  4052. Escherichia coli UMEA 3220-1 tRNA-Phe
  4053. Escherichia coli UMEA 3221-1 tRNA-Phe
  4054. Escherichia coli UMEA 3222-1 tRNA-Phe
  4055. Escherichia coli UMEA 3230-1 tRNA-Phe
  4056. Escherichia coli UMEA 3233-1 tRNA-Phe
  4057. Escherichia coli UMEA 3240-1 tRNA-Phe
  4058. Escherichia coli UMEA 3244-1 tRNA-Phe
  4059. Escherichia coli UMEA 3252-1 tRNA-Phe
  4060. Escherichia coli UMEA 3257-1 tRNA-Phe
  4061. Escherichia coli UMEA 3264-1 tRNA-Phe
  4062. Escherichia coli UMEA 3268-1 tRNA-Phe
  4063. Escherichia coli UMEA 3271-1 tRNA-Phe
  4064. Escherichia coli UMEA 3290-1 tRNA-Phe
  4065. Escherichia coli UMEA 3292-1 tRNA-Phe
  4066. Escherichia coli UMEA 3298-1 tRNA-Phe
  4067. Escherichia coli UMEA 3304-1 tRNA-Phe
  4068. Escherichia coli UMEA 3314-1 tRNA-Phe
  4069. Escherichia coli UMEA 3317-1 tRNA-Phe
  4070. Escherichia coli UMEA 3318-1 tRNA-Phe
  4071. Escherichia coli UMEA 3323-1 tRNA-Phe
  4072. Escherichia coli UMEA 3329-1 tRNA-Phe
  4073. Escherichia coli UMEA 3336-1 tRNA-Phe
  4074. Escherichia coli UMEA 3337-1 tRNA-Phe
  4075. Escherichia coli UMEA 3341-1 tRNA-Phe
  4076. Escherichia coli UMEA 3342-1 tRNA-Phe
  4077. Escherichia coli UMEA 3355-1 tRNA-Phe
  4078. Escherichia coli UMEA 3391-1 tRNA-Phe
  4079. Escherichia coli UMEA 3426-1 tRNA-Phe
  4080. Escherichia coli UMEA 3489-1 tRNA-Phe
  4081. Escherichia coli UMEA 3490-1 tRNA-Phe
  4082. Escherichia coli UMEA 3585-1 tRNA-Phe
  4083. Escherichia coli UMEA 3592-1 tRNA-Phe
  4084. Escherichia coli UMEA 3609-1 tRNA-Phe
  4085. Escherichia coli UMEA 3617-1 tRNA-Phe
  4086. Escherichia coli UMEA 3632-1 tRNA-Phe
  4087. Escherichia coli UMEA 3652-1 tRNA-Phe
  4088. Escherichia coli UMEA 3656-1 tRNA-Phe
  4089. Escherichia coli UMEA 3662-1 tRNA-Phe
  4090. Escherichia coli UMEA 3671-1 tRNA-Phe
  4091. Escherichia coli UMEA 3682-1 tRNA-Phe
  4092. Escherichia coli UMEA 3687-1 tRNA-Phe
  4093. Escherichia coli UMEA 3693-1 tRNA-Phe
  4094. Escherichia coli UMEA 3694-1 tRNA-Phe
  4095. Escherichia coli UMEA 3702-1 tRNA-Phe
  4096. Escherichia coli UMEA 3703-1 tRNA-Phe
  4097. Escherichia coli UMEA 3705-1 tRNA-Phe
  4098. Escherichia coli UMEA 3707-1 tRNA-Phe
  4099. Escherichia coli UMEA 3718-1 tRNA-Phe
  4100. Escherichia coli UMEA 3805-1 tRNA-Phe
  4101. Escherichia coli UMEA 3821-1 tRNA-Phe
  4102. Escherichia coli UMEA 3834-1 tRNA-Phe
  4103. Escherichia coli UMEA 3889-1 tRNA-Phe
  4104. Escherichia coli UMEA 3893-1 tRNA-Phe
  4105. Escherichia coli UMEA 3899-1 tRNA-Phe
  4106. Escherichia coli UMEA 3955-1 tRNA-Phe
  4107. Escherichia coli UMEA 4075-1 tRNA-Phe
  4108. Escherichia coli UMEA 4076-1 tRNA-Phe
  4109. Escherichia coli UMEA 4207-1 tRNA-Phe
  4110. Escherichia coli UMN026 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4111. Escherichia coli UMNF18 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4112. Escherichia coli UMNK88 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4113. Escherichia coli UTI89 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4114. Escherichia coli VL2732 tRNA-Phe
  4115. Escherichia coli VL2874 tRNA-Phe
  4116. Escherichia coli VR50 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4117. Escherichia coli W26 tRNA-Phe
  4118. Escherichia coli W tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4119. Escherichia coli XH001 tRNA-Phe
  4120. Escherichia coli Xuzhou21 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  4121. Escherichia coli ZH063 tRNA-Phe
  4122. Escherichia coli ZH071 tRNA-Phe
  4123. Escherichia coli ZH164 tRNA-Phe
  4124. Escherichia fergusonii ATCC 35469 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4125. Escherichia fergusonii B253 tRNA-Phe
  4126. Escherichia fergusonii tRNA-Phe(gaa)
  4127. Escherichia marmotae tRNA-Phe(gaa)
  4128. Escherichia O24:H4 tRNA-Phe
  4129. Escherichia O78:H4 tRNA-Phe
  4130. Escherichia O88:H52 tRNA-Phe
  4131. Escherichia ruysiae tRNA-Phe
  4132. Escherichia sp. 0.2392 tRNA-Phe
  4133. Escherichia sp. 10290 tRNA-Phe
  4134. Escherichia sp. 11.1596 tRNA-Phe
  4135. Escherichia sp. 11.1597 tRNA-Phe
  4136. Escherichia sp. 11.1600 tRNA-Phe
  4137. Escherichia sp. 1_1_43 tRNA-Phe
  4138. Escherichia sp. 12.2610 tRNA-Phe
  4139. Escherichia sp. 12.2612 tRNA-Phe
  4140. Escherichia sp. 14.0982 tRNA-Phe
  4141. Escherichia sp. 14.0985 tRNA-Phe
  4142. Escherichia sp. 14.0993 tRNA-Phe
  4143. Escherichia sp. 20412-1 tRNA-Phe
  4144. Escherichia sp. 264_2022 tRNA-Phe
  4145. Escherichia sp. 4_1_40B tRNA-Phe
  4146. Escherichia sp. 4726-5 tRNA-Phe
  4147. Escherichia sp. 79.0191 tRNA-Phe
  4148. Escherichia sp. 8.2195 tRNA-Phe
  4149. Escherichia sp. 92.1228 tRNA-Phe
  4150. Escherichia sp. 93.0724 tRNA-Phe
  4151. Escherichia sp. 93.0743 tRNA-Phe
  4152. Escherichia sp. 93.0750 tRNA-Phe
  4153. Escherichia sp. 93.0816 tRNA-Phe
  4154. Escherichia sp. 93.1447 tRNA-Phe
  4155. Escherichia sp. 93.1462 tRNA-Phe
  4156. Escherichia sp. 93.1518 tRNA-Phe
  4157. Escherichia sp. 94.0001 tRNA-Phe
  4158. Escherichia sp. AP1243 tRNA-Phe
  4159. Escherichia sp. AP1362 tRNA-Phe
  4160. Escherichia sp. AP1580 tRNA-Phe
  4161. Escherichia sp. AP1800 tRNA-Phe
  4162. Escherichia sp. AP915 tRNA-Phe
  4163. Escherichia sp. apec-93 tRNA-Phe
  4164. Escherichia sp. Brlt_15 tRNA-Phe
  4165. Escherichia sp. C600e-pL53T-1e tRNA-Phe
  4166. Escherichia sp. C600e-pL53T-2e tRNA-Phe
  4167. Escherichia sp. C600e-pL53T-3e tRNA-Phe
  4168. Escherichia sp. C600-pL53T tRNA-Phe
  4169. Escherichia sp. DSM 109009 tRNA-Phe
  4170. Escherichia sp. E10V10 tRNA-Phe
  4171. Escherichia sp. E10V4 tRNA-Phe
  4172. Escherichia sp. E10V5 tRNA-Phe
  4173. Escherichia sp. E1130 tRNA-Phe
  4174. Escherichia sp. E13S3 tRNA-Phe
  4175. Escherichia sp. E14S1 tRNA-Phe
  4176. Escherichia sp. E14V10 tRNA-Phe
  4177. Escherichia sp. E14V5 tRNA-Phe
  4178. Escherichia sp. E14V7 tRNA-Phe
  4179. Escherichia sp. E1S7 tRNA-Phe
  4180. Escherichia sp. E1V33 tRNA-Phe
  4181. Escherichia sp. E2562 tRNA-Phe
  4182. Escherichia sp. E2586 tRNA-Phe
  4183. Escherichia sp. E2593 tRNA-Phe
  4184. Escherichia sp. E2661 tRNA-Phe
  4185. Escherichia sp. E2748 tRNA-Phe
  4186. Escherichia sp. E3356 tRNA-Phe
  4187. Escherichia sp. E3659 tRNA-Phe
  4188. Escherichia sp. E4208 tRNA-Phe
  4189. Escherichia sp. E4385 tRNA-Phe
  4190. Escherichia sp. E4694 tRNA-Phe
  4191. Escherichia sp. E4702 tRNA-Phe
  4192. Escherichia sp. E4736 tRNA-Phe
  4193. Escherichia sp. E4742 tRNA-Phe
  4194. Escherichia sp. E4930 tRNA-Phe
  4195. Escherichia sp. E5028 tRNA-Phe
  4196. Escherichia sp. Ec20190506 tRNA-Phe
  4197. Escherichia sp. ESNIH1 tRNA-Phe
  4198. Escherichia sp. E.sYA108 tRNA-Phe
  4199. Escherichia sp. F1 tRNA-Phe
  4200. Escherichia sp. Gen1 tRNA-Phe
  4201. Escherichia sp. HC-CC4 tRNA-Phe
  4202. Escherichia sp. HC-CC tRNA-Phe
  4203. Escherichia sp. HC-TM1 tRNA-Phe
  4204. Escherichia sp. HH091_1A tRNA-Phe
  4205. Escherichia sp. HH154_1D tRNA-Phe
  4206. Escherichia sp. HH26CH tRNA-Phe
  4207. Escherichia sp. HH41S tRNA-Phe
  4208. Escherichia sp. JL983 tRNA-Phe
  4209. Escherichia sp. KCJ4928 tRNA-Phe
  4210. Escherichia sp. KCJ4943 tRNA-Phe
  4211. Escherichia sp. KS167_9B tRNA-Phe
  4212. Escherichia sp. KTE114 tRNA-Phe
  4213. Escherichia sp. KTE11 tRNA-Phe
  4214. Escherichia sp. KTE159 tRNA-Phe
  4215. Escherichia sp. KTE172 tRNA-Phe
  4216. Escherichia sp. KTE31 tRNA-Phe
  4217. Escherichia sp. KTE52 tRNA-Phe
  4218. Escherichia sp. KTE96 tRNA-Phe
  4219. Escherichia hominis tRNA-Phe
  4220. Escherichia sp. LST-B1 tRNA-Phe
  4221. Escherichia sp. M593 tRNA-Phe
  4222. Escherichia sp. M605 tRNA-Phe
  4223. Escherichia sp. M608 tRNA-Phe
  4224. Escherichia sp. M609 tRNA-Phe
  4225. Escherichia sp. M612 tRNA-Phe
  4226. Escherichia sp. M623 tRNA-Phe
  4227. Escherichia sp. M626 tRNA-Phe
  4228. Escherichia sp. MAL-1 tRNA-Phe
  4229. Escherichia sp. MOD1-EC5451 tRNA-Phe
  4230. Escherichia sp. MOD1-EC6475 tRNA-Phe
  4231. Escherichia sp. MR tRNA-Phe
  4232. Escherichia sp. NIC10 tRNA-Phe
  4233. Escherichia sp. NIC12-1 tRNA-Phe
  4234. Escherichia sp. NIC18-1 tRNA-Phe
  4235. Escherichia sp. NIC20 tRNA-Phe
  4236. Escherichia sp. NIC24-2-1 tRNA-Phe
  4237. Escherichia sp. NIC26-1 tRNA-Phe
  4238. Escherichia sp. NIC32-2 tRNA-Phe
  4239. Escherichia sp. NIC3-2 tRNA-Phe
  4240. Escherichia sp. NIC33 tRNA-Phe
  4241. Escherichia sp. NIC4-1 tRNA-Phe
  4242. Escherichia sp. NIC5-1 tRNA-Phe
  4243. Escherichia sp. NT35 tRNA-Phe
  4244. Escherichia sp. NT45 tRNA-Phe
  4245. Escherichia sp. R8 tRNA-Phe
  4246. Escherichia sp. R-CC3 tRNA-Phe
  4247. Escherichia sp. S10b tRNA-Phe
  4248. Escherichia sp. S2_ASV_4 tRNA-Phe
  4249. Escherichia sp. S69_ASV_4 tRNA-Phe
  4250. Escherichia sp. S85_ASV_4 tRNA-Phe
  4251. Escherichia whittamii tRNA-Phe
  4252. Escherichia sp. SCLE84 tRNA-Phe
  4253. Escherichia sp. SP-MK2 tRNA-Phe
  4254. Escherichia sp. SS-MK2 tRNA-Phe
  4255. Escherichia sp. TC-EC600-tetX4 tRNA-Phe
  4256. Escherichia sp. TF21-Red tRNA-Phe
  4257. Escherichia sp. TM-G17TGC tRNA-Phe
  4258. Escherichia sp. UTM R2 tRNA-Phe
  4259. Escherichia sp. (wastewater metagenome) tRNA-Phe
  4260. Escherichia sp. WS1038 tRNA-Phe
  4261. Escherichia sp. WS1041 tRNA-Phe
  4262. Escherichia sp. WS1063 tRNA-Phe
  4263. Escherichia sp. WS1085 tRNA-Phe
  4264. Escherichia sp. WS1088 tRNA-Phe
  4265. Escherichia sp. WS1112 tRNA-Phe
  4266. Escherichia sp. WS1114 tRNA-Phe
  4267. Escherichia sp. WS1118 tRNA-Phe
  4268. Escherichia sp. WS1152 tRNA-Phe
  4269. Escherichia sp. WS1211 tRNA-Phe
  4270. Escherichia sp. WS1212 tRNA-Phe
  4271. Escherichia sp. WS1265 tRNA-Phe
  4272. Escherichia sp. WS1342 tRNA-Phe
  4273. Escherichia sp. WS1348 tRNA-Phe
  4274. Escherichia sp. WS1368 tRNA-Phe
  4275. Escherichia sp. WS1377 tRNA-Phe
  4276. Escherichia sp. WS1384 tRNA-Phe
  4277. Escherichia sp. WS1419 tRNA-Phe
  4278. Escherichia sp. WS1421 tRNA-Phe
  4279. Escherichia sp. WS1440 tRNA-Phe
  4280. Escherichia sp. WS1450 tRNA-Phe
  4281. Escherichia sp. WS1451 tRNA-Phe
  4282. Escherichia sp. WS1482 tRNA-Phe
  4283. Escherichia sp. WS1620 tRNA-Phe
  4284. Escherichia sp. WS1667 tRNA-Phe
  4285. Escherichia sp. WS1707 tRNA-Phe
  4286. Escherichia sp. WS1771 tRNA-Phe
  4287. Escherichia sp. WS1780 tRNA-Phe
  4288. Escherichia sp. WS1853 tRNA-Phe
  4289. Escherichia sp. WS1860 tRNA-Phe
  4290. Escherichia sp. WS1864 tRNA-Phe
  4291. Escherichia sp. WS1876-2 tRNA-Phe
  4292. Escherichia sp. WS2031 tRNA-Phe
  4293. Escherichia sp. WS2035 tRNA-Phe
  4294. Escherichia sp. WS2055 tRNA-Phe
  4295. Escherichia sp. WS2170 tRNA-Phe
  4296. Escherichia sp. WS2171 tRNA-Phe
  4297. Escherichia sp. WS2312 tRNA-Phe
  4298. Escherichia sp. WS2328_1 tRNA-Phe
  4299. Escherichia sp. WS2328_2 tRNA-Phe
  4300. Escherichia sp. WS2339 tRNA-Phe
  4301. Escherichia sp. WS2422 tRNA-Phe
  4302. Escherichia sp. WS2423 tRNA-Phe
  4303. Escherichia sp. WS2442 tRNA-Phe
  4304. Escherichia sp. WS2659_1 tRNA-Phe
  4305. Escherichia sp. WS2659_2 tRNA-Phe
  4306. Escherichia sp. WS2690 tRNA-Phe
  4307. Escherichia sp. WS2868 tRNA-Phe
  4308. Escherichia sp. WS288 tRNA-Phe
  4309. Escherichia sp. WS2893_1 tRNA-Phe
  4310. Escherichia sp. WS2893_2 tRNA-Phe
  4311. Escherichia sp. WS2932 tRNA-Phe
  4312. Escherichia sp. WS293 tRNA-Phe
  4313. Escherichia sp. WS3009 tRNA-Phe
  4314. Escherichia sp. WS3063 tRNA-Phe
  4315. Escherichia sp. WS3066 tRNA-Phe
  4316. Escherichia sp. WS3074 tRNA-Phe
  4317. Escherichia sp. WS3096 tRNA-Phe
  4318. Escherichia sp. WS3108 tRNA-Phe
  4319. Escherichia sp. WS3202 tRNA-Phe
  4320. Escherichia sp. WS3224_2 tRNA-Phe
  4321. Escherichia sp. WS3227_1 tRNA-Phe
  4322. Escherichia sp. WS3227_2 tRNA-Phe
  4323. Escherichia sp. WS3267 tRNA-Phe
  4324. Escherichia sp. WS3286 tRNA-Phe
  4325. Escherichia sp. WS3345 tRNA-Phe
  4326. Escherichia sp. WS338 tRNA-Phe
  4327. Escherichia sp. WS33 tRNA-Phe
  4328. Escherichia sp. WS401 tRNA-Phe
  4329. Escherichia sp. WS436 tRNA-Phe
  4330. Escherichia sp. WS449 tRNA-Phe
  4331. Escherichia sp. WS453 tRNA-Phe
  4332. Escherichia sp. WS470 tRNA-Phe
  4333. Escherichia sp. WS495 tRNA-Phe
  4334. Escherichia sp. WS498 tRNA-Phe
  4335. Escherichia sp. WS499 tRNA-Phe
  4336. Escherichia sp. WS500 tRNA-Phe
  4337. Escherichia sp. WS504 tRNA-Phe
  4338. Escherichia sp. WS522 tRNA-Phe
  4339. Escherichia sp. WS533 tRNA-Phe
  4340. Escherichia sp. WS539 tRNA-Phe
  4341. Escherichia sp. WS545 tRNA-Phe
  4342. Escherichia sp. WS547 tRNA-Phe
  4343. Escherichia sp. WS553 tRNA-Phe
  4344. Escherichia sp. WS568 tRNA-Phe
  4345. Escherichia sp. WS569 tRNA-Phe
  4346. Escherichia sp. WS575 tRNA-Phe
  4347. Staphylococcus aureus subsp. aureus NCTC 8325 E-site tRNA CHAIN from Staphylococcus aureus subsp. aureus NCTC 8325 (PDB 5TCU, chain D)
  4348. Thermus thermophilus E-SITE TRNA from Thermus thermophilus (PDB 4V68, chain AW)
  4349. Saccharomyces cerevisiae EUKARYOTIC RIBOSOMAL P_E TRNA from Saccharomyces cerevisiae (PDB 4V8Y, chain CW)
  4350. Ewingella allii tRNA-Phe
  4351. Ewingella americana ATCC 33852 tRNA-Phe
  4352. Ewingella americana tRNA-Phe
  4353. Ewingella docleensis tRNA-Phe
  4354. Ewingella sp. AOP8-B2-18 tRNA-Phe
  4355. Ewingella sp. AOP9-I1-14 tRNA-Phe
  4356. Finegoldia magna tRNA-Phe
  4357. Franconibacter daqui tRNA-Phe
  4358. Franconibacter helveticus 1159 tRNA-Phe
  4359. Franconibacter helveticus 513 tRNA-Phe
  4360. Franconibacter helveticus (terrestrial metagenome) tRNA-Phe
  4361. Franconibacter pulveris 1160 tRNA-Phe
  4362. Franconibacter pulveris 601 tRNA-Phe
  4363. Franconibacter pulveris tRNA-Phe
  4364. Franconibacter sp. IITDAS19 tRNA-Phe
  4365. Gammaproteobacteria bacterium tRNA-Phe
  4366. Gibbsiella dentisursi tRNA-Phe
  4367. Gibbsiella greigii tRNA-Phe
  4368. Gibbsiella quercinecans tRNA-Phe
  4369. Glycomyces scopariae tRNA-Phe
  4370. Haemophilus haemolyticus tRNA-Phe
  4371. Hafnia alvei ATCC 13337 tRNA-Phe
  4372. Hafnia alvei ATCC 51873 tRNA-Phe
  4373. Hafnia alvei FB1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4374. Hafnia alvei tRNA-Phe
  4375. Hafnia paralvei ATCC 29927 tRNA-Phe
  4376. Hafnia paralvei tRNA-Phe
  4377. Hafnia sp. HMSC23F03 tRNA-Phe
  4378. Hafnia sp. KE9867 tRNA-Phe
  4379. Hafnia sp. tRNA-Phe
  4380. Halioglobus sp. tRNA-Phe
  4381. Huaxiibacter chinensis tRNA-Phe
  4382. human skin metagenome tRNA
  4383. Klebsiella aerogenes EA1509E tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4384. Klebsiella aerogenes KCTC 2190 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4385. Klebsiella aerogenes MGH 61 tRNA-Phe
  4386. Klebsiella aerogenes MGH 62 tRNA-Phe
  4387. Klebsiella aerogenes MGH 77 tRNA-Phe
  4388. Klebsiella aerogenes MGH 78 tRNA-Phe
  4389. Klebsiella aerogenes tRNA-Phe
  4390. Klebsiella aerogenes UCI 15 tRNA-Phe
  4391. Klebsiella aerogenes UCI 16 tRNA-Phe
  4392. Klebsiella aerogenes UCI 27 tRNA-Phe
  4393. Klebsiella aerogenes UCI 28 tRNA-Phe
  4394. Klebsiella aerogenes UCI 45 tRNA-Phe
  4395. Klebsiella aerogenes UCI 46 tRNA-Phe
  4396. Klebsiella aerogenes UCI 47 tRNA-Phe
  4397. Klebsiella aerogenes UCI 48 tRNA-Phe
  4398. Klebsiella africana tRNA-Phe
  4399. Klebsiella electrica tRNA-Phe
  4400. Klebsiella grimontii tRNA-Phe
  4401. Klebsiella lignicola tRNA-Phe
  4402. Klebsiella michiganensis E718 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4403. Klebsiella michiganensis HKOPL1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4404. Klebsiella michiganensis KCTC 1686 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4405. Klebsiella michiganensis M5al tRNA-Phe
  4406. Klebsiella michiganensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4407. Klebsiella ornithinolytica B6 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4408. Klebsiella ornithinolytica tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4409. Klebsiella oxytoca 09-7231 tRNA-Phe
  4410. Klebsiella oxytoca 10-5243 tRNA-Phe
  4411. Klebsiella oxytoca 10-5244 tRNA-Phe
  4412. Klebsiella oxytoca 10-5245 tRNA-Phe
  4413. Klebsiella oxytoca 10-5248 tRNA-Phe
  4414. Klebsiella oxytoca 10-5249 tRNA-Phe
  4415. Klebsiella oxytoca G54 tRNA-Phe
  4416. Klebsiella oxytoca (human gut metagenome) tRNA-Phe
  4417. Klebsiella oxytoca KA-2 tRNA-Phe
  4418. Klebsiella oxytoca KONIH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4419. Klebsiella oxytoca MGH 27 tRNA-Phe
  4420. Klebsiella oxytoca MGH 28 tRNA-Phe
  4421. Klebsiella oxytoca MGH 41 tRNA-Phe
  4422. Klebsiella oxytoca MGH 42 tRNA-Phe
  4423. Klebsiella oxytoca OK-1 tRNA-Phe
  4424. Klebsiella pasteurii tRNA-Phe(gaa)
  4425. Klebsiella planticola tRNA-Phe
  4426. Klebsiella pneumoniae 160_1080 tRNA-Phe
  4427. Klebsiella pneumoniae 303K tRNA-Phe
  4428. Klebsiella pneumoniae 30660/NJST258_1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4429. Klebsiella pneumoniae 30684/NJST258_2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4430. Klebsiella pneumoniae 500_1420 tRNA-Phe
  4431. Klebsiella pneumoniae ATCC BAA-1705 tRNA-Phe
  4432. Klebsiella pneumoniae ATCC BAA-2146 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4433. Klebsiella pneumoniae BIDMC 10 tRNA-Phe
  4434. Klebsiella pneumoniae BIDMC 11 tRNA-Phe
  4435. Klebsiella pneumoniae BIDMC 12A tRNA-Phe
  4436. Klebsiella pneumoniae BIDMC 12B tRNA-Phe
  4437. Klebsiella pneumoniae BIDMC 12C tRNA-Phe
  4438. Klebsiella pneumoniae BIDMC 13 tRNA-Phe
  4439. Klebsiella pneumoniae BIDMC 14 tRNA-Phe
  4440. Klebsiella pneumoniae BIDMC 16 tRNA-Phe
  4441. Klebsiella pneumoniae BIDMC 18A tRNA-Phe
  4442. Klebsiella pneumoniae BIDMC 18B tRNA-Phe
  4443. Klebsiella pneumoniae BIDMC 18C tRNA-Phe
  4444. Klebsiella pneumoniae BIDMC 18D tRNA-Phe
  4445. Klebsiella pneumoniae BIDMC 1 tRNA-Phe
  4446. Klebsiella pneumoniae BIDMC 21 tRNA-Phe
  4447. Klebsiella pneumoniae BIDMC 22 tRNA-Phe
  4448. Klebsiella pneumoniae BIDMC 23 tRNA-Phe
  4449. Klebsiella pneumoniae BIDMC 24 tRNA-Phe
  4450. Klebsiella pneumoniae BIDMC 25 tRNA-Phe
  4451. Klebsiella pneumoniae BIDMC 2A tRNA-Phe
  4452. Klebsiella pneumoniae BIDMC 31 tRNA-Phe
  4453. Klebsiella pneumoniae BIDMC 32 tRNA-Phe
  4454. Klebsiella pneumoniae BIDMC 33B tRNA-Phe
  4455. Klebsiella pneumoniae BIDMC 34 tRNA-Phe
  4456. Klebsiella pneumoniae BIDMC 35 tRNA-Phe
  4457. Klebsiella pneumoniae BIDMC 36 tRNA-Phe
  4458. Klebsiella pneumoniae BIDMC 40 tRNA-Phe
  4459. Klebsiella pneumoniae BIDMC 41 tRNA-Phe
  4460. Klebsiella pneumoniae BIDMC 42a tRNA-Phe
  4461. Klebsiella pneumoniae BIDMC 42b tRNA-Phe
  4462. Klebsiella pneumoniae BIDMC 45 tRNA-Phe
  4463. Klebsiella pneumoniae BIDMC 46a tRNA-Phe
  4464. Klebsiella pneumoniae BIDMC 46b tRNA-Phe
  4465. Klebsiella pneumoniae BIDMC 47 tRNA-Phe
  4466. Klebsiella pneumoniae BIDMC 48 tRNA-Phe
  4467. Klebsiella pneumoniae BIDMC 4 tRNA-Phe
  4468. Klebsiella pneumoniae BIDMC 51 tRNA-Phe
  4469. Klebsiella pneumoniae BIDMC 52 tRNA-Phe
  4470. Klebsiella pneumoniae BIDMC 53 tRNA-Phe
  4471. Klebsiella pneumoniae BIDMC 54 tRNA-Phe
  4472. Klebsiella pneumoniae BIDMC 55 tRNA-Phe
  4473. Klebsiella pneumoniae BIDMC 5 tRNA-Phe
  4474. Klebsiella pneumoniae BIDMC 60 tRNA-Phe
  4475. Klebsiella pneumoniae BIDMC 68 tRNA-Phe
  4476. Klebsiella pneumoniae BIDMC 69 tRNA-Phe
  4477. Klebsiella pneumoniae BIDMC 7A tRNA-Phe
  4478. Klebsiella pneumoniae BIDMC 7B tRNA-Phe
  4479. Klebsiella pneumoniae BWH 15 tRNA-Phe
  4480. Klebsiella pneumoniae BWH 22 tRNA-Phe
  4481. Klebsiella pneumoniae BWH 28 tRNA-Phe
  4482. Klebsiella pneumoniae BWH 2 tRNA-Phe
  4483. Klebsiella pneumoniae BWH 30 tRNA-Phe
  4484. Klebsiella pneumoniae BWH 36 tRNA-Phe
  4485. Klebsiella pneumoniae BWH 41 tRNA-Phe
  4486. Klebsiella pneumoniae BWH 45 tRNA-Phe
  4487. Klebsiella pneumoniae BWH 46 tRNA-Phe
  4488. Klebsiella pneumoniae BWH 47 tRNA-Phe
  4489. Klebsiella pneumoniae BWH 48 tRNA-Phe
  4490. Klebsiella pneumoniae CG43 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4491. Klebsiella pneumoniae CHS 01 tRNA-Phe
  4492. Klebsiella pneumoniae CHS 02 tRNA-Phe
  4493. Klebsiella pneumoniae CHS 03 tRNA-Phe
  4494. Klebsiella pneumoniae CHS 04 tRNA-Phe
  4495. Klebsiella pneumoniae CHS 05 tRNA-Phe
  4496. Klebsiella pneumoniae CHS 06 tRNA-Phe
  4497. Klebsiella pneumoniae CHS 07 tRNA-Phe
  4498. Klebsiella pneumoniae CHS 08 tRNA-Phe
  4499. Klebsiella pneumoniae CHS 09 tRNA-Phe
  4500. Klebsiella pneumoniae CHS 11 tRNA-Phe
  4501. Klebsiella pneumoniae CHS 12 tRNA-Phe
  4502. Klebsiella pneumoniae CHS 13 tRNA-Phe
  4503. Klebsiella pneumoniae CHS 14 tRNA-Phe
  4504. Klebsiella pneumoniae CHS 16 tRNA-Phe
  4505. Klebsiella pneumoniae CHS 17 tRNA-Phe
  4506. Klebsiella pneumoniae CHS 18 tRNA-Phe
  4507. Klebsiella pneumoniae CHS 19 tRNA-Phe
  4508. Klebsiella pneumoniae CHS 20 tRNA-Phe
  4509. Klebsiella pneumoniae CHS 21 tRNA-Phe
  4510. Klebsiella pneumoniae CHS 22 tRNA-Phe
  4511. Klebsiella pneumoniae CHS 23 tRNA-Phe
  4512. Klebsiella pneumoniae CHS 24 tRNA-Phe
  4513. Klebsiella pneumoniae CHS 25 tRNA-Phe
  4514. Klebsiella pneumoniae CHS 26 tRNA-Phe
  4515. Klebsiella pneumoniae CHS 27 tRNA-Phe
  4516. Klebsiella pneumoniae CHS 28 tRNA-Phe
  4517. Klebsiella pneumoniae CHS 29 tRNA-Phe
  4518. Klebsiella pneumoniae CHS 30 tRNA-Phe
  4519. Klebsiella pneumoniae CHS 31 tRNA-Phe
  4520. Klebsiella pneumoniae CHS 32 tRNA-Phe
  4521. Klebsiella pneumoniae CHS 33 tRNA-Phe
  4522. Klebsiella pneumoniae CHS 34 tRNA-Phe
  4523. Klebsiella pneumoniae CHS 35 tRNA-Phe
  4524. Klebsiella pneumoniae CHS 36 tRNA-Phe
  4525. Klebsiella pneumoniae CHS 37 tRNA-Phe
  4526. Klebsiella pneumoniae CHS 38 tRNA-Phe
  4527. Klebsiella pneumoniae CHS 39 tRNA-Phe
  4528. Klebsiella pneumoniae CHS 40 tRNA-Phe
  4529. Klebsiella pneumoniae CHS 41 tRNA-Phe
  4530. Klebsiella pneumoniae CHS 42 tRNA-Phe
  4531. Klebsiella pneumoniae CHS 43 tRNA-Phe
  4532. Klebsiella pneumoniae CHS 44 tRNA-Phe
  4533. Klebsiella pneumoniae CHS 45 tRNA-Phe
  4534. Klebsiella pneumoniae CHS 46 tRNA-Phe
  4535. Klebsiella pneumoniae CHS 47 tRNA-Phe
  4536. Klebsiella pneumoniae CHS 48 tRNA-Phe
  4537. Klebsiella pneumoniae CHS 49 tRNA-Phe
  4538. Klebsiella pneumoniae CHS 50 tRNA-Phe
  4539. Klebsiella pneumoniae CHS 51 tRNA-Phe
  4540. Klebsiella pneumoniae CHS 52 tRNA-Phe
  4541. Klebsiella pneumoniae CHS 53 tRNA-Phe
  4542. Klebsiella pneumoniae CHS 54 tRNA-Phe
  4543. Klebsiella pneumoniae CHS 55 tRNA-Phe
  4544. Klebsiella pneumoniae CHS 56 tRNA-Phe
  4545. Klebsiella pneumoniae CHS 57 tRNA-Phe
  4546. Klebsiella pneumoniae CHS 58 tRNA-Phe
  4547. Klebsiella pneumoniae CHS 59 tRNA-Phe
  4548. Klebsiella pneumoniae CHS 60 tRNA-Phe
  4549. Klebsiella pneumoniae CHS 61 tRNA-Phe
  4550. Klebsiella pneumoniae CHS 62 tRNA-Phe
  4551. Klebsiella pneumoniae CHS 63 tRNA-Phe
  4552. Klebsiella pneumoniae CHS 64 tRNA-Phe
  4553. Klebsiella pneumoniae CHS 65 tRNA-Phe
  4554. Klebsiella pneumoniae CHS 66 tRNA-Phe
  4555. Klebsiella pneumoniae CHS 67 tRNA-Phe
  4556. Klebsiella pneumoniae CHS 70 tRNA-Phe
  4557. Klebsiella pneumoniae CHS 71 tRNA-Phe
  4558. Klebsiella pneumoniae CHS 72 tRNA-Phe
  4559. Klebsiella pneumoniae CHS 73 tRNA-Phe
  4560. Klebsiella pneumoniae CHS 74 tRNA-Phe
  4561. Klebsiella pneumoniae CHS 75 tRNA-Phe
  4562. Klebsiella pneumoniae CHS 76 tRNA-Phe
  4563. Klebsiella pneumoniae CHS 80 tRNA-Phe
  4564. Klebsiella pneumoniae complex sp. WS1009 tRNA-Phe
  4565. Klebsiella pneumoniae complex sp. WS1115 tRNA-Phe
  4566. Klebsiella pneumoniae complex sp. WS1778 tRNA-Phe
  4567. Klebsiella pneumoniae complex sp. WS1875 tRNA-Phe
  4568. Klebsiella pneumoniae complex sp. WS1876_1 tRNA-Phe
  4569. Klebsiella pneumoniae complex sp. WS2436 tRNA-Phe
  4570. Klebsiella pneumoniae complex sp. WS2972 tRNA-Phe
  4571. Klebsiella pneumoniae complex sp. WS308 tRNA-Phe
  4572. Klebsiella pneumoniae complex sp. WS3221 tRNA-Phe
  4573. Klebsiella pneumoniae complex sp. WS3224_1 tRNA-Phe
  4574. Klebsiella pneumoniae complex sp. WS619 tRNA-Phe
  4575. Klebsiella pneumoniae complex sp. WS658 tRNA-Phe
  4576. Klebsiella pneumoniae complex sp. WS992 tRNA-Phe
  4577. Klebsiella pneumoniae DMC1097 tRNA-Phe
  4578. Klebsiella pneumoniae EGD-HP19-C tRNA-Phe
  4579. Klebsiella pneumoniae HE12 tRNA-Phe
  4580. Klebsiella pneumoniae HK787 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4581. Klebsiella pneumoniae JM45 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4582. Klebsiella pneumoniae Kb140 tRNA-Phe
  4583. Klebsiella pneumoniae Kb677 tRNA-Phe
  4584. Klebsiella pneumoniae KCTC 2242 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4585. Klebsiella pneumoniae KP-1 tRNA-Phe
  4586. Klebsiella pneumoniae MGH 17 tRNA-Phe
  4587. Klebsiella pneumoniae MGH 18 tRNA-Phe
  4588. Klebsiella pneumoniae MGH 19 tRNA-Phe
  4589. Klebsiella pneumoniae MGH 21 tRNA-Phe
  4590. Klebsiella pneumoniae MGH 29 tRNA-Phe
  4591. Klebsiella pneumoniae MGH 30 tRNA-Phe
  4592. Klebsiella pneumoniae MGH 31 tRNA-Phe
  4593. Klebsiella pneumoniae MGH 32 tRNA-Phe
  4594. Klebsiella pneumoniae MGH 35 tRNA-Phe
  4595. Klebsiella pneumoniae MGH 36 tRNA-Phe
  4596. Klebsiella pneumoniae MGH 39 tRNA-Phe
  4597. Klebsiella pneumoniae MGH 43 tRNA-Phe
  4598. Klebsiella pneumoniae MGH 45 tRNA-Phe
  4599. Klebsiella pneumoniae MGH 46 tRNA-Phe
  4600. Klebsiella pneumoniae MGH 47 tRNA-Phe
  4601. Klebsiella pneumoniae MGH 48 tRNA-Phe
  4602. Klebsiella pneumoniae MGH 51 tRNA-Phe
  4603. Klebsiella pneumoniae MGH 52 tRNA-Phe
  4604. Klebsiella pneumoniae MGH 59 tRNA-Phe
  4605. Klebsiella pneumoniae MGH 60 tRNA-Phe
  4606. Klebsiella pneumoniae MGH 63 tRNA-Phe
  4607. Klebsiella pneumoniae MGH 64 tRNA-Phe
  4608. Klebsiella pneumoniae MGH 65 tRNA-Phe
  4609. Klebsiella pneumoniae MGH 66 tRNA-Phe
  4610. Klebsiella pneumoniae MGH 67 tRNA-Phe
  4611. Klebsiella pneumoniae MGH 69 tRNA-Phe
  4612. Klebsiella pneumoniae MGH 70 tRNA-Phe
  4613. Klebsiella pneumoniae MGH 71 tRNA-Phe
  4614. Klebsiella pneumoniae MGH 72 tRNA-Phe
  4615. Klebsiella pneumoniae MGH 73 tRNA-Phe
  4616. Klebsiella pneumoniae MGH 74 tRNA-Phe
  4617. Klebsiella pneumoniae MGH 75 tRNA-Phe
  4618. Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Klebsiella pneumoniae MGH 78578 tRNA-Phe
  4619. Klebsiella pneumoniae MGH 79 tRNA-Phe
  4620. Klebsiella pneumoniae MRSN 1319 tRNA-Phe
  4621. Klebsiella pneumoniae MRSN 2404 tRNA-Phe
  4622. Klebsiella pneumoniae MRSN 3562 tRNA-Phe
  4623. Klebsiella pneumoniae MRSN 3852 tRNA-Phe
  4624. Klebsiella pneumoniae MRSN 6902 tRNA-Phe
  4625. Klebsiella pneumoniae NB60 tRNA-Phe
  4626. Klebsiella pneumoniae RYC492 tRNA-Phe
  4627. Klebsiella pneumoniae subsp. ozaenae tRNA-Phe(gaa)
  4628. Klebsiella pneumoniae subsp. pneumoniae 1084 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4629. Klebsiella pneumoniae subsp. pneumoniae 1158 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4630. Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 tRNA-Phe
  4631. Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 tRNA-Phe
  4632. Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 tRNA-Phe
  4633. Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 tRNA-Phe
  4634. Klebsiella pneumoniae subsp. pneumoniae Ecl8 tRNA-Phe
  4635. Klebsiella pneumoniae subsp. pneumoniae HS11286 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4636. Klebsiella pneumoniae subsp. pneumoniae Kp001 tRNA-Phe
  4637. Klebsiella pneumoniae subsp. pneumoniae Kp13 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4638. Klebsiella pneumoniae subsp. pneumoniae KpMDU1 tRNA-Phe
  4639. Klebsiella pneumoniae subsp. pneumoniae KPNIH10 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4640. Klebsiella pneumoniae subsp. pneumoniae KPNIH11 tRNA-Phe
  4641. Klebsiella pneumoniae subsp. pneumoniae KPNIH12 tRNA-Phe
  4642. Klebsiella pneumoniae subsp. pneumoniae KPNIH14 tRNA-Phe
  4643. Klebsiella pneumoniae subsp. pneumoniae KPNIH16 tRNA-Phe
  4644. Klebsiella pneumoniae subsp. pneumoniae KPNIH17 tRNA-Phe
  4645. Klebsiella pneumoniae subsp. pneumoniae KPNIH18 tRNA-Phe
  4646. Klebsiella pneumoniae subsp. pneumoniae KPNIH19 tRNA-Phe
  4647. Klebsiella pneumoniae subsp. pneumoniae KPNIH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4648. Klebsiella pneumoniae subsp. pneumoniae KPNIH20 tRNA-Phe
  4649. Klebsiella pneumoniae subsp. pneumoniae KPNIH21 tRNA-Phe
  4650. Klebsiella pneumoniae subsp. pneumoniae KPNIH22 tRNA-Phe
  4651. Klebsiella pneumoniae subsp. pneumoniae KPNIH23 tRNA-Phe
  4652. Klebsiella pneumoniae subsp. pneumoniae KPNIH24 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4653. Klebsiella pneumoniae subsp. pneumoniae KPNIH27 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4654. Klebsiella pneumoniae subsp. pneumoniae KPNIH2 tRNA-Phe
  4655. Klebsiella pneumoniae subsp. pneumoniae KPNIH4 tRNA-Phe
  4656. Klebsiella pneumoniae subsp. pneumoniae KPNIH5 tRNA-Phe
  4657. Klebsiella pneumoniae subsp. pneumoniae KPNIH6 tRNA-Phe
  4658. Klebsiella pneumoniae subsp. pneumoniae KPNIH7 tRNA-Phe
  4659. Klebsiella pneumoniae subsp. pneumoniae KPNIH8 tRNA-Phe
  4660. Klebsiella pneumoniae subsp. pneumoniae KPNIH9 tRNA-Phe
  4661. Klebsiella pneumoniae subsp. pneumoniae KpO3210 tRNA-Phe
  4662. Klebsiella pneumoniae subsp. pneumoniae KPR0928 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4663. Klebsiella pneumoniae subsp. pneumoniae MGH 78578 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4664. Klebsiella pneumoniae subsp. pneumoniae MP14 tRNA-Phe
  4665. Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4666. Klebsiella pneumoniae subsp. pneumoniae PittNDM01 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4667. Klebsiella pneumoniae subsp. pneumoniae SA1 tRNA-Phe
  4668. Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO tRNA-Phe-GAA
  4669. Klebsiella pneumoniae subsp. pneumoniae tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4670. Klebsiella pneumoniae subsp. pneumoniae UKKV901664 tRNA-Phe
  4671. Klebsiella pneumoniae subsp. pneumoniae WGLW1 tRNA-Phe
  4672. Klebsiella pneumoniae subsp. pneumoniae WGLW2 tRNA-Phe
  4673. Klebsiella pneumoniae subsp. pneumoniae WGLW3 tRNA-Phe
  4674. Klebsiella pneumoniae subsp. pneumoniae WGLW5 tRNA-Phe
  4675. Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 tRNA-Phe
  4676. Klebsiella pneumoniae subsp. rhinoscleromatis SB3432 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4677. Klebsiella pneumoniae subsp. rhinoscleromatis tRNA-Phe(gaa)
  4678. Klebsiella pneumoniae tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  4679. Klebsiella pneumoniae U-0608239 tRNA-Phe
  4680. Klebsiella pneumoniae UCI 17 tRNA-Phe
  4681. Klebsiella pneumoniae UCI 19 tRNA-Phe
  4682. Klebsiella pneumoniae UCI 20 tRNA-Phe
  4683. Klebsiella pneumoniae UCI 21 tRNA-Phe
  4684. Klebsiella pneumoniae UCI 22 tRNA-Phe
  4685. Klebsiella pneumoniae UCI 25 tRNA-Phe
  4686. Klebsiella pneumoniae UCI 26 tRNA-Phe
  4687. Klebsiella pneumoniae UCI 33 tRNA-Phe
  4688. Klebsiella pneumoniae UCI 34 tRNA-Phe
  4689. Klebsiella pneumoniae UCI 37 tRNA-Phe
  4690. Klebsiella pneumoniae UCI 38 tRNA-Phe
  4691. Klebsiella pneumoniae UCI 41 tRNA-Phe
  4692. Klebsiella pneumoniae UCI 42 tRNA-Phe
  4693. Klebsiella pneumoniae UCI 43 tRNA-Phe
  4694. Klebsiella pneumoniae UCI 44 tRNA-Phe
  4695. Klebsiella pneumoniae UCI 55 tRNA-Phe
  4696. Klebsiella pneumoniae UCI 56 tRNA-Phe
  4697. Klebsiella pneumoniae UCI 59 tRNA-Phe
  4698. Klebsiella pneumoniae UCI 60 tRNA-Phe
  4699. Klebsiella pneumoniae UCI 61 tRNA-Phe
  4700. Klebsiella pneumoniae UCI 62 tRNA-Phe
  4701. Klebsiella pneumoniae UCI 63 tRNA-Phe
  4702. Klebsiella pneumoniae UCI 64 tRNA-Phe
  4703. Klebsiella pneumoniae UCI 67 tRNA-Phe
  4704. Klebsiella pneumoniae UCI 68 tRNA-Phe
  4705. Klebsiella pneumoniae UCICRE 13 tRNA-Phe
  4706. Klebsiella pneumoniae UCICRE 1 tRNA-Phe
  4707. Klebsiella pneumoniae UCICRE 2 tRNA-Phe
  4708. Klebsiella pneumoniae UCICRE 4 tRNA-Phe
  4709. Klebsiella pneumoniae UCICRE 6 tRNA-Phe
  4710. Klebsiella pneumoniae UCICRE 7 tRNA-Phe
  4711. Klebsiella pneumoniae UCICRE 8 tRNA-Phe
  4712. Klebsiella pneumoniae UHKPC05 tRNA-Phe
  4713. Klebsiella pneumoniae UHKPC07 tRNA-Phe
  4714. Klebsiella pneumoniae UHKPC33 tRNA-Phe
  4715. Klebsiella pneumoniae UHKPC45 tRNA-Phe
  4716. Klebsiella pneumoniae UHKPC 52 tRNA-Phe
  4717. Klebsiella pneumoniae VA360 tRNA-Phe
  4718. Klebsiella pneumoniae VAKPC278 tRNA-Phe
  4719. Klebsiella quasipneumoniae subsp. quasipneumoniae tRNA-Phe(gaa)
  4720. Klebsiella quasipneumoniae subsp. similipneumoniae tRNA-Phe(gaa)
  4721. Klebsiella quasipneumoniae tRNA-Phe(gaa)
  4722. Klebsiella quasivariicola tRNA-Phe(gaa)
  4723. Klebsiella scottii tRNA-Phe
  4724. Klebsiella sp. 100962 tRNA-Phe
  4725. Klebsiella sp. 101062 tRNA-Phe
  4726. Klebsiella sp. 101193 tRNA-Phe
  4727. Klebsiella sp. 101298 tRNA-Phe
  4728. Klebsiella sp. 102043 tRNA-Phe
  4729. Klebsiella sp. 102123 tRNA-Phe
  4730. Klebsiella sp. 102294 tRNA-Phe
  4731. Klebsiella sp. 102304 tRNA-Phe
  4732. Klebsiella sp. 102738 tRNA-Phe
  4733. Klebsiella sp. 102816 tRNA-Phe
  4734. Klebsiella sp. 103027 tRNA-Phe
  4735. Klebsiella sp. 103198 tRNA-Phe
  4736. Klebsiella sp. 103596 tRNA-Phe
  4737. Klebsiella sp. 103903 tRNA-Phe
  4738. Klebsiella sp. 104055 tRNA-Phe
  4739. Klebsiella sp. 104116 tRNA-Phe
  4740. Klebsiella sp. 104352 tRNA-Phe
  4741. Klebsiella sp. 104360 tRNA-Phe
  4742. Klebsiella sp. 104714 tRNA-Phe
  4743. Klebsiella sp. 104722 tRNA-Phe
  4744. Klebsiella sp. 104938 tRNA-Phe
  4745. Klebsiella sp. 105354 tRNA-Phe
  4746. Klebsiella sp. 105384 tRNA-Phe
  4747. Klebsiella sp. 106183 tRNA-Phe
  4748. Klebsiella sp. 106704 tRNA-Phe
  4749. Klebsiella sp. 109139 tRNA-Phe
  4750. Klebsiella sp. 10982 tRNA-Phe
  4751. Klebsiella sp. 110189 tRNA-Phe
  4752. Klebsiella sp. 111863 tRNA-Phe
  4753. Klebsiella sp. CVUAS 11263 tRNA-Phe
  4754. Klebsiella sp. 113667 tRNA-Phe
  4755. Klebsiella sp. 115594 tRNA-Phe
  4756. Klebsiella sp. 116378 tRNA-Phe
  4757. Klebsiella sp. 116495 tRNA-Phe
  4758. Klebsiella sp. 116683 tRNA-Phe
  4759. Klebsiella sp. 117654 tRNA-Phe
  4760. Klebsiella sp. 117902 tRNA-Phe
  4761. Klebsiella sp. 118026 tRNA-Phe
  4762. Klebsiella sp. 118468 tRNA-Phe
  4763. Klebsiella sp. 119538 tRNA-Phe
  4764. Klebsiella sp. 119590 tRNA-Phe
  4765. Klebsiella sp. 119743 tRNA-Phe
  4766. Klebsiella sp. 1-1 tRNA-Phe
  4767. Klebsiella sp. 120904 tRNA-Phe
  4768. Klebsiella sp. 121470 tRNA-Phe
  4769. Klebsiella sp. 121960 tRNA-Phe
  4770. Klebsiella sp. 122401 tRNA-Phe
  4771. Klebsiella sp. 122498 tRNA-Phe
  4772. Klebsiella sp. 123336 tRNA-Phe
  4773. Klebsiella sp. 123462 tRNA-Phe
  4774. Klebsiella sp. 123601 tRNA-Phe
  4775. Klebsiella sp. 123737 tRNA-Phe
  4776. Klebsiella sp. 123751 tRNA-Phe
  4777. Klebsiella sp. 123941 tRNA-Phe
  4778. Klebsiella sp. 123993 tRNA-Phe
  4779. Klebsiella sp. 124188 tRNA-Phe
  4780. Klebsiella sp. 124401 tRNA-Phe
  4781. Klebsiella sp. 124734 tRNA-Phe
  4782. Klebsiella sp. 125062 tRNA-Phe
  4783. Klebsiella sp. 125182 tRNA-Phe
  4784. Klebsiella sp. 127213 tRNA-Phe
  4785. Klebsiella sp. 127573 tRNA-Phe
  4786. Klebsiella sp. 128420 tRNA-Phe
  4787. Klebsiella sp. 128481 tRNA-Phe
  4788. Klebsiella sp. 128797 tRNA-Phe
  4789. Klebsiella sp. 128897 tRNA-Phe
  4790. Klebsiella sp. 129172 tRNA-Phe
  4791. Klebsiella sp. 129229 tRNA-Phe
  4792. Klebsiella sp. 129969 tRNA-Phe
  4793. Klebsiella sp. 1-2 tRNA-Phe
  4794. Klebsiella sp. 130084 tRNA-Phe
  4795. Klebsiella sp. 131256 tRNA-Phe
  4796. Klebsiella sp. 131511 tRNA-Phe
  4797. Klebsiella sp. 132108 tRNA-Phe
  4798. Klebsiella sp. 132494 tRNA-Phe
  4799. Klebsiella sp. 135505 tRNA-Phe
  4800. Klebsiella sp. 136913 tRNA-Phe
  4801. Klebsiella sp. 136999 tRNA-Phe
  4802. Klebsiella sp. 138958 tRNA-Phe
  4803. Klebsiella sp. 139993 tRNA-Phe
  4804. Klebsiella sp. 1400 tRNA-Phe
  4805. Klebsiella sp. 141130 tRNA-Phe
  4806. Klebsiella sp. 141153 tRNA-Phe
  4807. Klebsiella sp. 141161 tRNA-Phe
  4808. Klebsiella sp. 141162 tRNA-Phe
  4809. Klebsiella sp. 141196 tRNA-Phe
  4810. Klebsiella sp. 141198 tRNA-Phe
  4811. Klebsiella sp. 141203 tRNA-Phe
  4812. Klebsiella sp. 141219 tRNA-Phe
  4813. Klebsiella sp. 141240 tRNA-Phe
  4814. Klebsiella sp. 141251 tRNA-Phe
  4815. Klebsiella sp. 141994 tRNA-Phe
  4816. Klebsiella sp. 142732 tRNA-Phe
  4817. Klebsiella sp. 14_CIP_Kleb tRNA-Phe
  4818. Klebsiella sp. 1-A tRNA-Phe
  4819. Klebsiella sp. 1-B tRNA-Phe
  4820. Klebsiella sp. 1-C tRNA-Phe
  4821. Klebsiella sp. 1HUBk17cef tRNA-Phe
  4822. Klebsiella sp. 1RDAk6cef tRNA-Phe
  4823. Klebsiella sp. 1RDBk3mer tRNA-Phe
  4824. Klebsiella sp. 1RUBe7cef tRNA-Phe
  4825. Klebsiella sp. 1SHAk5cef tRNA-Phe
  4826. Klebsiella sp. 1SIAk7mer tRNA-Phe
  4827. Klebsiella sp. 1SOAk1mer tRNA-Phe
  4828. Klebsiella sp. 1SOBk10mer tRNA-Phe
  4829. Klebsiella sp. 1SOBk11mer tRNA-Phe
  4830. Klebsiella sp. 1SOBk12mer tRNA-Phe
  4831. Klebsiella sp. 1SOBk13mer tRNA-Phe
  4832. Klebsiella sp. 1SOBk2mer tRNA-Phe
  4833. Klebsiella sp. 1SOBk5mer tRNA-Phe
  4834. Klebsiella sp. 1SOBk7mer tRNA-Phe
  4835. Klebsiella sp. 1SOBk8mer tRNA-Phe
  4836. Klebsiella sp. 2019SCSN059 tRNA-Phe
  4837. Klebsiella sp. 20_CIP_Kleb tRNA-Phe
  4838. Klebsiella sp. 20IR1034 tRNA-Phe
  4839. Klebsiella sp. 20_N_Kleb tRNA-Phe
  4840. Klebsiella sp. 2-CIP_Kleb. tRNA-Phe
  4841. Klebsiella sp. 2HUAk32cef tRNA-Phe
  4842. Klebsiella sp. 2HUAk36cef tRNA-Phe
  4843. Klebsiella sp. 2HUBk12mer tRNA-Phe
  4844. Klebsiella sp. 2HUBk32mer tRNA-Phe
  4845. Klebsiella sp. 2HUCk22cef tRNA-Phe
  4846. Klebsiella sp. 2HUCk3cef tRNA-Phe
  4847. Klebsiella sp. 2-N_Kleb. tRNA-Phe
  4848. Klebsiella sp. 2SIBct4cefB tRNA-Phe
  4849. Klebsiella sp. 3-N_Kleb. tRNA-Phe
  4850. Klebsiella sp. 4_1_44FAA tRNA-Phe
  4851. Klebsiella sp. 70687 tRNA-Phe
  4852. Klebsiella sp. 70963 tRNA-Phe
  4853. Klebsiella sp. 71163 tRNA-Phe
  4854. Klebsiella sp. 71382 tRNA-Phe
  4855. Klebsiella sp. 71387 tRNA-Phe
  4856. Klebsiella sp. 71963 tRNA-Phe
  4857. Klebsiella sp. 72125 tRNA-Phe
  4858. Klebsiella sp. 72742 tRNA-Phe
  4859. Klebsiella sp. 73225 tRNA-Phe
  4860. Klebsiella sp. 73548 tRNA-Phe
  4861. Klebsiella sp. 73633 tRNA-Phe
  4862. Klebsiella sp. 74550 tRNA-Phe
  4863. Klebsiella sp. 74589 tRNA-Phe
  4864. Klebsiella sp. 75322 tRNA-Phe
  4865. Klebsiella sp. 75366 tRNA-Phe
  4866. Klebsiella sp. 75581 tRNA-Phe
  4867. Klebsiella sp. 75660 tRNA-Phe
  4868. Klebsiella sp. 75686 tRNA-Phe
  4869. Klebsiella sp. 75989 tRNA-Phe
  4870. Klebsiella sp. 76256 tRNA-Phe
  4871. Klebsiella sp. 76492 tRNA-Phe
  4872. Klebsiella sp. 76556 tRNA-Phe
  4873. Klebsiella sp. 76619 tRNA-Phe
  4874. Klebsiella sp. 76621 tRNA-Phe
  4875. Klebsiella sp. 76637 tRNA-Phe
  4876. Klebsiella sp. 76952 tRNA-Phe
  4877. Klebsiella sp. 77324 tRNA-Phe
  4878. Klebsiella sp. 77381 tRNA-Phe
  4879. Klebsiella sp. 77549 tRNA-Phe
  4880. Klebsiella sp. 78106 tRNA-Phe
  4881. Klebsiella sp. 78128 tRNA-Phe
  4882. Klebsiella sp. 78179 tRNA-Phe
  4883. Klebsiella sp. 78195 tRNA-Phe
  4884. Klebsiella sp. 78592 tRNA-Phe
  4885. Klebsiella sp. 78778 tRNA-Phe
  4886. Klebsiella sp. 79012 tRNA-Phe
  4887. Klebsiella sp. 79351 tRNA-Phe
  4888. Klebsiella sp. 79945 tRNA-Phe
  4889. Klebsiella sp. 7-CIP_Kleb. tRNA-Phe
  4890. Klebsiella sp. 80315 tRNA-Phe
  4891. Klebsiella sp. 80617 tRNA-Phe
  4892. Klebsiella sp. 80660 tRNA-Phe
  4893. Klebsiella sp. 81231 tRNA-Phe
  4894. Klebsiella sp. 81322 tRNA-Phe
  4895. Klebsiella sp. 82156 tRNA-Phe
  4896. Klebsiella sp. 82685 tRNA-Phe
  4897. Klebsiella sp. 83669 tRNA-Phe
  4898. Klebsiella sp. 84133 tRNA-Phe
  4899. Klebsiella sp. 84153 tRNA-Phe
  4900. Klebsiella sp. 86357 tRNA-Phe
  4901. Klebsiella sp. 86663 tRNA-Phe
  4902. Klebsiella sp. 86937 tRNA-Phe
  4903. Klebsiella sp. 89780 tRNA-Phe
  4904. Klebsiella sp. 90403 tRNA-Phe
  4905. Klebsiella sp. 90675 tRNA-Phe
  4906. Klebsiella sp. 90739 tRNA-Phe
  4907. Klebsiella sp. 90847 tRNA-Phe
  4908. Klebsiella sp. 90877 tRNA-Phe
  4909. Klebsiella sp. 90920 tRNA-Phe
  4910. Klebsiella sp. 90937 tRNA-Phe
  4911. Klebsiella sp. 90977 tRNA-Phe
  4912. Klebsiella sp. 91194 tRNA-Phe
  4913. Klebsiella sp. 91301 tRNA-Phe
  4914. Klebsiella sp. 91424 tRNA-Phe
  4915. Klebsiella sp. 91557 tRNA-Phe
  4916. Klebsiella sp. 91673 tRNA-Phe
  4917. Klebsiella sp. 91681 tRNA-Phe
  4918. Klebsiella sp. 91970 tRNA-Phe
  4919. Klebsiella sp. 92007 tRNA-Phe
  4920. Klebsiella sp. 92020 tRNA-Phe
  4921. Klebsiella sp. 92160 tRNA-Phe
  4922. Klebsiella sp. 92188 tRNA-Phe
  4923. Klebsiella sp. 92307 tRNA-Phe
  4924. Klebsiella sp. 92357 tRNA-Phe
  4925. Klebsiella sp. 92358 tRNA-Phe
  4926. Klebsiella sp. 92372 tRNA-Phe
  4927. Klebsiella sp. 92496 tRNA-Phe
  4928. Klebsiella sp. 92729 tRNA-Phe
  4929. Klebsiella sp. 92888 tRNA-Phe
  4930. Klebsiella sp. 92946 tRNA-Phe
  4931. Klebsiella sp. 92978 tRNA-Phe
  4932. Klebsiella sp. 93177 tRNA-Phe
  4933. Klebsiella sp. 93217 tRNA-Phe
  4934. Klebsiella sp. 93238 tRNA-Phe
  4935. Klebsiella sp. 93445 tRNA-Phe
  4936. Klebsiella sp. 93467 tRNA-Phe
  4937. Klebsiella sp. 93737 tRNA-Phe
  4938. Klebsiella sp. 93746 tRNA-Phe
  4939. Klebsiella sp. 93934 tRNA-Phe
  4940. Klebsiella sp. 95068 tRNA-Phe
  4941. Klebsiella sp. 95070 tRNA-Phe
  4942. Klebsiella sp. 95904 tRNA-Phe
  4943. Klebsiella sp. 95941 tRNA-Phe
  4944. Klebsiella sp. 96009 tRNA-Phe
  4945. Klebsiella sp. 96044 tRNA-Phe
  4946. Klebsiella sp. 96093 tRNA-Phe
  4947. Klebsiella sp. 96873 tRNA-Phe
  4948. Klebsiella sp. 96938 tRNA-Phe
  4949. Klebsiella sp. 97147 tRNA-Phe
  4950. Klebsiella sp. 97211 tRNA-Phe
  4951. Klebsiella sp. 97291 tRNA-Phe
  4952. Klebsiella sp. 97624 tRNA-Phe
  4953. Klebsiella sp. 97683 tRNA-Phe
  4954. Klebsiella sp. 97981 tRNA-Phe
  4955. Klebsiella sp. 98171 tRNA-Phe
  4956. Klebsiella sp. 98334 tRNA-Phe
  4957. Klebsiella sp. 98340 tRNA-Phe
  4958. Klebsiella sp. 98394 tRNA-Phe
  4959. Klebsiella sp. 98516 tRNA-Phe
  4960. Klebsiella sp. 98583 tRNA-Phe
  4961. Klebsiella sp. 98632 tRNA-Phe
  4962. Klebsiella sp. 98703 tRNA-Phe
  4963. Klebsiella sp. 98919 tRNA-Phe
  4964. Klebsiella sp. 99316 tRNA-Phe
  4965. Klebsiella sp. 99317 tRNA-Phe
  4966. Klebsiella sp. 99336 tRNA-Phe
  4967. Klebsiella sp. 99573 tRNA-Phe
  4968. Klebsiella sp. 99607 tRNA-Phe
  4969. Klebsiella sp. 99871 tRNA-Phe
  4970. Klebsiella sp. 99913 tRNA-Phe
  4971. Klebsiella sp. A52 tRNA-Phe
  4972. Klebsiella sp. AA405 tRNA-Phe
  4973. Klebsiella sp. Acro-833 tRNA-Phe
  4974. Klebsiella sp. Acro-834 tRNA-Phe
  4975. Klebsiella spallanzanii tRNA-Phe(gaa)
  4976. Klebsiella sp. A-Nf5 tRNA-Phe
  4977. Klebsiella sp. Ap-873 tRNA-Phe
  4978. Klebsiella sp. Ap-874 tRNA-Phe
  4979. Klebsiella sp. AqSCr tRNA-Phe
  4980. Klebsiella sp. AS10 tRNA-Phe
  4981. Klebsiella sp. B22-8034 tRNA-Phe
  4982. Klebsiella sp. B345 tRNA-Phe
  4983. Klebsiella sp. BA397-4A_EMB tRNA-Phe
  4984. Klebsiella sp. BDA134-6 tRNA-Phe
  4985. Klebsiella sp. BIGb0132 tRNA-Phe
  4986. Klebsiella sp. BIGb0407 tRNA-Phe
  4987. Klebsiella sp. B-Nf7 tRNA-Phe
  4988. Klebsiella sp. C1-16S-Nf17 tRNA-Phe
  4989. Klebsiella sp. C142 tRNA-Phe
  4990. Klebsiella sp. C194 tRNA-Phe
  4991. Klebsiella sp. C197 tRNA-Phe
  4992. Klebsiella sp. C228 tRNA-Phe
  4993. Klebsiella sp. C230 tRNA-Phe
  4994. Klebsiella sp. C236 tRNA-Phe
  4995. Klebsiella sp. C239 tRNA-Phe
  4996. Klebsiella sp. C244 tRNA-Phe
  4997. Klebsiella sp. C250 tRNA-Phe
  4998. Klebsiella sp. C253 tRNA-Phe
  4999. Klebsiella sp. C255 tRNA-Phe
  5000. Klebsiella sp. C260 tRNA-Phe
  5001. Klebsiella sp. C267 tRNA-Phe
  5002. Klebsiella sp. C282 tRNA-Phe
  5003. Klebsiella sp. C283 tRNA-Phe
  5004. Klebsiella sp. C304 tRNA-Phe
  5005. Klebsiella sp. C310 tRNA-Phe
  5006. Klebsiella sp. C311 tRNA-Phe
  5007. Klebsiella sp. C312 tRNA-Phe
  5008. Klebsiella sp. C314 tRNA-Phe
  5009. Klebsiella sp. C325 tRNA-Phe
  5010. Klebsiella sp. C349492 tRNA-Phe
  5011. Klebsiella sp. C360 tRNA-Phe
  5012. Klebsiella sp. C382 tRNA-Phe
  5013. Klebsiella sp. C386 tRNA-Phe
  5014. Klebsiella sp. C387 tRNA-Phe
  5015. Klebsiella sp. C390 tRNA-Phe
  5016. Klebsiella sp. C402 tRNA-Phe
  5017. Klebsiella sp. C408 tRNA-Phe
  5018. Klebsiella sp. C80 tRNA-Phe
  5019. Klebsiella sp. CB_Kp191 tRNA-Phe
  5020. Klebsiella sp. CB_Kp192 tRNA-Phe
  5021. Klebsiella sp. CB_Kp193 tRNA-Phe
  5022. Klebsiella sp. CB_Kp194 tRNA-Phe
  5023. Klebsiella sp. CB_Kp195 tRNA-Phe
  5024. Klebsiella sp. CB_Kp196 tRNA-Phe
  5025. Klebsiella sp. CB_Kp197 tRNA-Phe
  5026. Klebsiella sp. CB_Kp198 tRNA-Phe
  5027. Klebsiella sp. CB_Kp200 tRNA-Phe
  5028. Klebsiella sp. CB_Kp203 tRNA-Phe
  5029. Klebsiella sp. CFKP142 tRNA-Phe
  5030. Klebsiella sp. CIP107 tRNA-Phe
  5031. Klebsiella sp. C-Nf10 tRNA-Phe
  5032. Klebsiella sp. CN_Kp066 tRNA-Phe
  5033. Klebsiella sp. CN_Kp073 tRNA-Phe
  5034. Klebsiella sp. CN_Kp075 tRNA-Phe
  5035. Klebsiella sp. CN_Kp084 tRNA-Phe
  5036. Klebsiella sp. CN_Kp088 tRNA-Phe
  5037. Klebsiella sp. CN_Kp089 tRNA-Phe
  5038. Klebsiella sp. CN_Kp090 tRNA-Phe
  5039. Klebsiella sp. CN_Kp091 tRNA-Phe
  5040. Klebsiella sp. CN_Kp093 tRNA-Phe
  5041. Klebsiella sp. CN_Kp094 tRNA-Phe
  5042. Klebsiella sp. CN_Kp096 tRNA-Phe
  5043. Klebsiella sp. CN_Kp097 tRNA-Phe
  5044. Klebsiella sp. CN_Kp098 tRNA-Phe
  5045. Klebsiella sp. CN_Kp100 tRNA-Phe
  5046. Klebsiella sp. CN_Kp104 tRNA-Phe
  5047. Klebsiella sp. CN_Kp105 tRNA-Phe
  5048. Klebsiella sp. CN_Kp106 tRNA-Phe
  5049. Klebsiella sp. CN_Kp107 tRNA-Phe
  5050. Klebsiella sp. CN_Kp108 tRNA-Phe
  5051. Klebsiella sp. CN_Kp109 tRNA-Phe
  5052. Klebsiella sp. CN_Kp113 tRNA-Phe
  5053. Klebsiella sp. CN_Kp114 tRNA-Phe
  5054. Klebsiella sp. CN_Kp115 tRNA-Phe
  5055. Klebsiella sp. CN_Kp116 tRNA-Phe
  5056. Klebsiella sp. CN_Kp117 tRNA-Phe
  5057. Klebsiella sp. CN_Kp118 tRNA-Phe
  5058. Klebsiella sp. CTHL.F3a tRNA-Phe
  5059. Klebsiella sp. CVUAS 10191.3 tRNA-Phe
  5060. Klebsiella sp. CVUAS 10975.2 tRNA-Phe
  5061. Klebsiella sp. CVUAS 11332 tRNA-Phe
  5062. Klebsiella sp. CVUAS 5466.2 tRNA-Phe
  5063. Klebsiella sp. CVUAS 8534.2 tRNA-Phe
  5064. Klebsiella sp. D-Nf1 tRNA-Phe
  5065. Klebsiella sp. DNRA6 tRNA-Phe
  5066. Klebsiella sp. DR_160cip tRNA-Phe
  5067. Klebsiella sp. DR_172cip tRNA-Phe
  5068. Klebsiella sp. Ech2A tRNA-Phe
  5069. Klebsiella sp. EMBS2024 tRNA-Phe
  5070. Klebsiella sp. E-Nf3 tRNA-Phe
  5071. Klebsiella sp. F11 tRNA-Phe
  5072. Klebsiella sp. F14 tRNA-Phe
  5073. Klebsiella sp. FDAARGOS_511 tRNA-Phe
  5074. Klebsiella sp. FK2020ZBJ35 tRNA-Phe
  5075. Klebsiella sp. F-Nf9 tRNA-Phe
  5076. Klebsiella sp. FYR_9 tRNA-Phe
  5077. Klebsiella sp. G21-3159 tRNA-Phe
  5078. Klebsiella sp. G21-3160 tRNA-Phe
  5079. Klebsiella sp. G21-3161 tRNA-Phe
  5080. Klebsiella sp. G21-3207 tRNA-Phe
  5081. Klebsiella sp. G2-16S-Nf13 tRNA-Phe
  5082. Klebsiella sp. G22-1690 tRNA-Phe
  5083. Klebsiella sp. G23-653 tRNA-Phe
  5084. Klebsiella sp. GB_Kp047 tRNA-Phe
  5085. Klebsiella sp. GB_Kp049 tRNA-Phe
  5086. Klebsiella sp. GB_Kp050 tRNA-Phe
  5087. Klebsiella sp. GB_Kp051 tRNA-Phe
  5088. Klebsiella sp. GB_Kp054 tRNA-Phe
  5089. Klebsiella sp. GB_Kp055 tRNA-Phe
  5090. Klebsiella sp. GB_Kp056 tRNA-Phe
  5091. Klebsiella sp. GB_Kp058 tRNA-Phe
  5092. Klebsiella sp. GB_Kp059 tRNA-Phe
  5093. Klebsiella sp. GB_Kp060 tRNA-Phe
  5094. Klebsiella sp. GB_Kp061 tRNA-Phe
  5095. Klebsiella sp. GB_Kp062 tRNA-Phe
  5096. Klebsiella sp. GFKo11 tRNA-Phe
  5097. Klebsiella sp. GG_Kp131 tRNA-Phe
  5098. Klebsiella sp. GG_Kp132 tRNA-Phe
  5099. Klebsiella sp. GG_Kp133 tRNA-Phe
  5100. Klebsiella sp. GG_Kp134 tRNA-Phe
  5101. Klebsiella sp. GG_Kp135 tRNA-Phe
  5102. Klebsiella sp. GG_Kp136 tRNA-Phe
  5103. Klebsiella sp. GG_Kp137 tRNA-Phe
  5104. Klebsiella sp. GG_Kp138 tRNA-Phe
  5105. Klebsiella sp. GG_Kp139 tRNA-Phe
  5106. Klebsiella sp. GG_Kp140 tRNA-Phe
  5107. Klebsiella sp. GG_Kp141 tRNA-Phe
  5108. Klebsiella sp. GG_Kp142 tRNA-Phe
  5109. Klebsiella sp. GG_Kp143 tRNA-Phe
  5110. Klebsiella sp. GG_Kp144 tRNA-Phe
  5111. Klebsiella sp. GG_Kp145 tRNA-Phe
  5112. Klebsiella sp. GG_Kp146 tRNA-Phe
  5113. Klebsiella sp. GG_Kp147 tRNA-Phe
  5114. Klebsiella sp. GG_Kp148 tRNA-Phe
  5115. Klebsiella sp. GG_Kp149 tRNA-Phe
  5116. Klebsiella sp. GG_Kp150 tRNA-Phe
  5117. Klebsiella sp. GG_Kp151 tRNA-Phe
  5118. Klebsiella sp. GG_Kp152 tRNA-Phe
  5119. Klebsiella sp. GG_Kp153 tRNA-Phe
  5120. Klebsiella sp. GG_Kp154 tRNA-Phe
  5121. Klebsiella sp. GG_Kp155 tRNA-Phe
  5122. Klebsiella sp. GG_Kp156 tRNA-Phe
  5123. Klebsiella sp. GG_Kp157 tRNA-Phe
  5124. Klebsiella sp. GG_Kp158 tRNA-Phe
  5125. Klebsiella sp. GG_Kp159 tRNA-Phe
  5126. Klebsiella sp. GG_Kp160 tRNA-Phe
  5127. Klebsiella sp. GG_Kp161 tRNA-Phe
  5128. Klebsiella sp. GG_Kp162 tRNA-Phe
  5129. Klebsiella sp. GG_Kp163 tRNA-Phe
  5130. Klebsiella sp. GG_Kp164 tRNA-Phe
  5131. Klebsiella sp. GG_Kp165 tRNA-Phe
  5132. Klebsiella sp. GG_Kp166 tRNA-Phe
  5133. Klebsiella sp. GG_Kp167 tRNA-Phe
  5134. Klebsiella sp. GG_Kp168 tRNA-Phe
  5135. Klebsiella sp. GG_Kp169 tRNA-Phe
  5136. Klebsiella sp. GG_Kp170 tRNA-Phe
  5137. Klebsiella sp. GG_Kp171 tRNA-Phe
  5138. Klebsiella sp. GG_Kp172 tRNA-Phe
  5139. Klebsiella sp. GG_Kp173 tRNA-Phe
  5140. Klebsiella sp. GG_Kp174 tRNA-Phe
  5141. Klebsiella sp. GG_Kp175 tRNA-Phe
  5142. Klebsiella sp. GG_Kp176 tRNA-Phe
  5143. Klebsiella sp. GG_Kp177 tRNA-Phe
  5144. Klebsiella sp. GG_Kp178 tRNA-Phe
  5145. Klebsiella sp. GG_Kp179 tRNA-Phe
  5146. Klebsiella sp. GG_Kp180 tRNA-Phe
  5147. Klebsiella sp. GL120222-02 tRNA-Phe
  5148. Klebsiella sp. G-Nf4 tRNA-Phe
  5149. Klebsiella sp. GN_Kp184 tRNA-Phe
  5150. Klebsiella sp. GN_Kp186 tRNA-Phe
  5151. Klebsiella sp. GN_Kp190 tRNA-Phe
  5152. Klebsiella sp. GW_Kp181 tRNA-Phe
  5153. Klebsiella sp. GW_Kp182 tRNA-Phe
  5154. Klebsiella sp. HMSC09D12 tRNA-Phe
  5155. Klebsiella sp. HMSC16A12 tRNA-Phe
  5156. Klebsiella sp. HMSC16C06 tRNA-Phe
  5157. Klebsiella sp. HMSC22F09 tRNA-Phe
  5158. Klebsiella sp. HMSC25G12 tRNA-Phe
  5159. Klebsiella sp. H-Nf2 tRNA-Phe
  5160. Klebsiella sp. HP194 tRNA-Phe
  5161. Klebsiella sp. HSTU-Sny5 tRNA-Phe
  5162. Klebsiella sp. I138 tRNA-Phe
  5163. Klebsiella sp. I-Nf8 tRNA-Phe
  5164. Klebsiella sp. JB_Kp001 tRNA-Phe
  5165. Klebsiella sp. JB_Kp002 tRNA-Phe
  5166. Klebsiella sp. JB_Kp003 tRNA-Phe
  5167. Klebsiella sp. JB_Kp004 tRNA-Phe
  5168. Klebsiella sp. JB_Kp005 tRNA-Phe
  5169. Klebsiella sp. JB_Kp006 tRNA-Phe
  5170. Klebsiella sp. JB_Kp007 tRNA-Phe
  5171. Klebsiella sp. JB_Kp008 tRNA-Phe
  5172. Klebsiella sp. JB_Kp009 tRNA-Phe
  5173. Klebsiella sp. JB_Kp010 tRNA-Phe
  5174. Klebsiella sp. JB_Kp011 tRNA-Phe
  5175. Klebsiella sp. JB_Kp013 tRNA-Phe
  5176. Klebsiella sp. JB_Kp014 tRNA-Phe
  5177. Klebsiella sp. JB_Kp015 tRNA-Phe
  5178. Klebsiella sp. JB_Kp016 tRNA-Phe
  5179. Klebsiella sp. JB_Kp017 tRNA-Phe
  5180. Klebsiella sp. JB_Kp018 tRNA-Phe
  5181. Klebsiella sp. JB_Kp019 tRNA-Phe
  5182. Klebsiella sp. JB_Kp020 tRNA-Phe
  5183. Klebsiella sp. JB_Kp021 tRNA-Phe
  5184. Klebsiella sp. JB_Kp022 tRNA-Phe
  5185. Klebsiella sp. JB_Kp023 tRNA-Phe
  5186. Klebsiella sp. JB_Kp024 tRNA-Phe
  5187. Klebsiella sp. JB_Kp025 tRNA-Phe
  5188. Klebsiella sp. JB_Kp026 tRNA-Phe
  5189. Klebsiella sp. JB_Kp027 tRNA-Phe
  5190. Klebsiella sp. JB_Kp028 tRNA-Phe
  5191. Klebsiella sp. JB_Kp029 tRNA-Phe
  5192. Klebsiella sp. JB_Kp030 tRNA-Phe
  5193. Klebsiella sp. JB_Kp031 tRNA-Phe
  5194. Klebsiella sp. JB_Kp032 tRNA-Phe
  5195. Klebsiella sp. JB_Kp033 tRNA-Phe
  5196. Klebsiella sp. JB_Kp034 tRNA-Phe
  5197. Klebsiella sp. JB_Kp035 tRNA-Phe
  5198. Klebsiella sp. JB_Kp036 tRNA-Phe
  5199. Klebsiella sp. JB_Kp037 tRNA-Phe
  5200. Klebsiella sp. JB_Kp038 tRNA-Phe
  5201. Klebsiella sp. JB_Kp039 tRNA-Phe
  5202. Klebsiella sp. JB_Kp040 tRNA-Phe
  5203. Klebsiella sp. JB_Kp041 tRNA-Phe
  5204. Klebsiella sp. JB_Kp042 tRNA-Phe
  5205. Klebsiella sp. JB_Kp043 tRNA-Phe
  5206. Klebsiella sp. JB_Kp044 tRNA-Phe
  5207. Klebsiella sp. JB_Kp045 tRNA-Phe
  5208. Klebsiella sp. JB_Kp046 tRNA-Phe
  5209. Klebsiella sp. JL973 tRNA-Phe
  5210. Klebsiella sp. J-Nf11 tRNA-Phe
  5211. Klebsiella sp. JN_Kp120 tRNA-Phe
  5212. Klebsiella sp. JN_Kp121 tRNA-Phe
  5213. Klebsiella sp. JN_Kp122 tRNA-Phe
  5214. Klebsiella sp. JN_Kp123 tRNA-Phe
  5215. Klebsiella sp. JN_Kp124 tRNA-Phe
  5216. Klebsiella sp. JN_Kp125 tRNA-Phe
  5217. Klebsiella sp. JN_Kp126 tRNA-Phe
  5218. Klebsiella sp. JN_Kp127 tRNA-Phe
  5219. Klebsiella sp. JN_Kp129 tRNA-Phe
  5220. Klebsiella sp. JN_Kp130 tRNA-Phe
  5221. Klebsiella sp. K4-130 tRNA-Phe
  5222. Klebsiella sp. K4-136 tRNA-Phe
  5223. Klebsiella sp. K4-154 tRNA-Phe
  5224. Klebsiella sp. K4-170 tRNA-Phe
  5225. Klebsiella sp. K4-172 tRNA-Phe
  5226. Klebsiella sp. K4-180 tRNA-Phe
  5227. Klebsiella sp. K4-188 tRNA-Phe
  5228. Klebsiella sp. K4-32 tRNA-Phe
  5229. Klebsiella sp. K4-38 tRNA-Phe
  5230. Klebsiella sp. K4-41 tRNA-Phe
  5231. Klebsiella sp. K4-44 tRNA-Phe
  5232. Klebsiella sp. K4-50 tRNA-Phe
  5233. Klebsiella sp. K4-74 tRNA-Phe
  5234. Klebsiella sp. K47 tRNA-Phe
  5235. Klebsiella sp. K4 tRNA-Phe
  5236. Klebsiella sp. K5-122 tRNA-Phe
  5237. Klebsiella sp. K5-175 tRNA-Phe
  5238. Klebsiella sp. K5-1 tRNA-Phe
  5239. Klebsiella sp. K5-204 tRNA-Phe
  5240. Klebsiella sp. K5-210 tRNA-Phe
  5241. Klebsiella sp. K5-212 tRNA-Phe
  5242. Klebsiella sp. K5-222 tRNA-Phe
  5243. Klebsiella sp. K5-229 tRNA-Phe
  5244. Klebsiella sp. K5-233 tRNA-Phe
  5245. Klebsiella sp. K5-306 tRNA-Phe
  5246. Klebsiella sp. K5-307 tRNA-Phe
  5247. Klebsiella sp. K5-308 tRNA-Phe
  5248. Klebsiella sp. K5-309 tRNA-Phe
  5249. Klebsiella sp. K5-310 tRNA-Phe
  5250. Klebsiella sp. K5-312 tRNA-Phe
  5251. Klebsiella sp. K5-314 tRNA-Phe
  5252. Klebsiella sp. K5-315 tRNA-Phe
  5253. Klebsiella sp. K5-321 tRNA-Phe
  5254. Klebsiella sp. K5-322 tRNA-Phe
  5255. Klebsiella sp. K5-45 tRNA-Phe
  5256. Klebsiella sp. K5-76 tRNA-Phe
  5257. Klebsiella sp. K5 tRNA-Phe
  5258. Klebsiella sp. K6-123-1 tRNA-Phe
  5259. Klebsiella sp. K6-138.1 tRNA-Phe
  5260. Klebsiella sp. K6-148 tRNA-Phe
  5261. Klebsiella sp. K6-183 tRNA-Phe
  5262. Klebsiella sp. K6-243 tRNA-Phe
  5263. Klebsiella sp. K6-322 tRNA-Phe
  5264. Klebsiella sp. K792 tRNA-Phe
  5265. Klebsiella sp. K794 tRNA-Phe
  5266. Klebsiella sp. K796 tRNA-Phe
  5267. Klebsiella sp. K804 tRNA-Phe
  5268. Klebsiella sp. K822 tRNA-Phe
  5269. Klebsiella sp. KBG1 tRNA-Phe
  5270. Klebsiella sp. KB_Kp057 tRNA-Phe
  5271. Klebsiella sp. Kd70 TUC-EEAOC tRNA-Phe
  5272. Klebsiella sp. KE9038 tRNA-Phe
  5273. Klebsiella sp. KE9456 tRNA-Phe
  5274. Klebsiella sp. KE9767 tRNA-Phe
  5275. Klebsiella sp. KG9 tRNA-Phe
  5276. Klebsiella sp. KJ_S1 tRNA-Phe
  5277. Klebsiella sp. K-Nf6 tRNA-Phe
  5278. Klebsiella sp. KOS9 tRNA-Phe
  5279. Klebsiella sp. KP20-425-1 tRNA-Phe
  5280. Klebsiella sp. KPN54798 tRNA-Phe
  5281. Klebsiella sp. Kpp tRNA-Phe
  5282. Klebsiella sp. Kps tRNA-Phe
  5283. Klebsiella sp. KTE92 tRNA-Phe
  5284. Klebsiella sp. LTGPAF-6F tRNA-Phe
  5285. Klebsiella sp. LY tRNA-Phe
  5286. Klebsiella sp. M581 tRNA-Phe
  5287. Klebsiella sp. M589 tRNA-Phe
  5288. Klebsiella sp. M5al tRNA-Phe
  5289. Klebsiella sp. M621 tRNA-Phe
  5290. Klebsiella sp. MBT K-1 tRNA-Phe
  5291. Klebsiella sp. MC1F tRNA-Phe
  5292. Klebsiella sp. ME-303 tRNA-Phe
  5293. Klebsiella sp. MISC125 tRNA-Phe
  5294. Klebsiella sp. MPUS7 tRNA-Phe
  5295. Klebsiella sp. MS 92-3 tRNA-Phe
  5296. Klebsiella sp. NFIX53 tRNA-Phe
  5297. Klebsiella sp. NPDC088457 tRNA-Phe
  5298. Klebsiella sp. O852 tRNA-Phe
  5299. Klebsiella sp. OBRC7 tRNA-Phe
  5300. Klebsiella sp. P1927 tRNA-Phe
  5301. Klebsiella sp. P1954 tRNA-Phe
  5302. Klebsiella sp. P1CD1 tRNA-Phe
  5303. Klebsiella sp. PB10 tRNA-Phe
  5304. Klebsiella sp. PB11 tRNA-Phe
  5305. Klebsiella sp. PB1 tRNA-Phe
  5306. Klebsiella sp. PB2 tRNA-Phe
  5307. Klebsiella sp. PB3 tRNA-Phe
  5308. Klebsiella sp. PB4 tRNA-Phe
  5309. Klebsiella sp. PB5 tRNA-Phe
  5310. Klebsiella sp. PB6 tRNA-Phe
  5311. Klebsiella sp. PB7 tRNA-Phe
  5312. Klebsiella sp. PB8 tRNA-Phe
  5313. Klebsiella sp. PB9 tRNA-Phe
  5314. Klebsiella sp. PCX tRNA-Phe
  5315. Klebsiella sp. PK18 tRNA-Phe
  5316. Klebsiella sp. PL-2018 tRNA-Phe
  5317. Klebsiella sp. PO552 tRNA-Phe
  5318. Klebsiella sp. R10 tRNA-Phe
  5319. Klebsiella sp. R12 tRNA-Phe
  5320. Klebsiella sp. R15 tRNA-Phe
  5321. Klebsiella sp. R18 tRNA-Phe
  5322. Klebsiella sp. R19 tRNA-Phe
  5323. Klebsiella sp. R22 tRNA-Phe
  5324. Klebsiella sp. R24 tRNA-Phe
  5325. Klebsiella sp. R26 tRNA-Phe
  5326. Klebsiella sp. R28 tRNA-Phe
  5327. Klebsiella sp. R2 tRNA-Phe
  5328. Klebsiella sp. R32 tRNA-Phe
  5329. Klebsiella sp. R33 tRNA-Phe
  5330. Klebsiella sp. R34 tRNA-Phe
  5331. Klebsiella sp. R35 tRNA-Phe
  5332. Klebsiella sp. R36 tRNA-Phe
  5333. Klebsiella sp. R38 tRNA-Phe
  5334. Klebsiella sp. R390 tRNA-Phe
  5335. Klebsiella sp. R445 tRNA-Phe
  5336. Klebsiella sp. R45 tRNA-Phe
  5337. Klebsiella sp. R48 tRNA-Phe
  5338. Klebsiella sp. R4 tRNA-Phe
  5339. Klebsiella sp. R51 tRNA-Phe
  5340. Klebsiella sp. R55 tRNA-Phe
  5341. Klebsiella sp. R56 tRNA-Phe
  5342. Klebsiella sp. R57 tRNA-Phe
  5343. Klebsiella sp. R58 tRNA-Phe
  5344. Klebsiella sp. R59 tRNA-Phe
  5345. Klebsiella sp. R61 tRNA-Phe
  5346. Klebsiella sp. R62 tRNA-Phe
  5347. Klebsiella sp. R63 tRNA-Phe
  5348. Klebsiella sp. R64 tRNA-Phe
  5349. Klebsiella sp. R65 tRNA-Phe
  5350. Klebsiella sp. R71 tRNA-Phe
  5351. Klebsiella sp. R77 tRNA-Phe
  5352. Klebsiella sp. R79 tRNA-Phe
  5353. Klebsiella sp. R80 tRNA-Phe
  5354. Klebsiella sp. R81 tRNA-Phe
  5355. Klebsiella sp. R82 tRNA-Phe
  5356. Klebsiella sp. R83 tRNA-Phe
  5357. Klebsiella sp. R9 tRNA-Phe
  5358. Klebsiella sp. RC2 tRNA-Phe
  5359. Klebsiella sp. RCJ4 tRNA-Phe
  5360. Klebsiella sp. RHBSTW-00215 tRNA-Phe
  5361. Klebsiella sp. RHBSTW-00464 tRNA-Phe
  5362. Klebsiella sp. RHBSTW-00465 tRNA-Phe
  5363. Klebsiella sp. RHBSTW-00484 tRNA-Phe
  5364. Klebsiella sp. RIT-PI-d tRNA-Phe
  5365. Klebsiella sp. S1 tRNA-Phe
  5366. Klebsiella sp. S69 tRNA-Phe
  5367. Klebsiella sp. Sb-30 tRNA-Phe
  5368. Klebsiella sp. SG01 tRNA-Phe
  5369. Klebsiella sp. SORGH_AS_0826 tRNA-Phe
  5370. Klebsiella sp. SORGH_AS_1025 tRNA-Phe
  5371. Klebsiella sp. SORGH_AS_1173 tRNA-Phe
  5372. Klebsiella sp. STW0522-44 tRNA-Phe
  5373. Klebsiella sp. SWET4 tRNA-Phe
  5374. Klebsiella sp. SYXHC3 tRNA-Phe
  5375. Klebsiella sp. T11 tRNA-Phe
  5376. Klebsiella sp. T2.Ur tRNA-Phe
  5377. Klebsiella sp. TF21-TM tRNA-Phe
  5378. Klebsiella sp. TFW1 tRNA-Phe
  5379. Klebsiella indica tRNA-Phe
  5380. Klebsiella sp. TYF_8 tRNA-Phe
  5381. Klebsiella sp. V115_8 tRNA-Phe
  5382. Klebsiella sp. tRNA-Phe
  5383. Klebsiella huaxiensis tRNA-Phe(gaa)
  5384. Klebsiella sp. WOUb02 tRNA-Phe
  5385. Klebsiella sp. WP3-S18-ESBL-05 tRNA-Phe
  5386. Klebsiella sp. WP3-W18-ESBL-02 tRNA-Phe
  5387. Klebsiella sp. WP4-W18-ESBL-05 tRNA-Phe
  5388. Klebsiella sp. WP7-S18-CRE-02 tRNA-Phe
  5389. Klebsiella sp. WP7-S18-CRE-03 tRNA-Phe
  5390. Klebsiella sp. WP7-S18-ESBL-04 tRNA-Phe
  5391. Klebsiella sp. WP8-S18-ESBL-06 tRNA-Phe
  5392. Klebsiella sp. WSY_19 tRNA-Phe
  5393. Klebsiella sp. X1-16S-Nf21 tRNA-Phe
  5394. Klebsiella sp. Z2 tRNA-Phe
  5395. Klebsiella sp. ZJOU C1 tRNA-Phe
  5396. Klebsiella sp. zjy_5 tRNA-Phe
  5397. Klebsiella sp. ZYC-1 tRNA-Phe
  5398. Klebsiella terrigena tRNA-Phe
  5399. Klebsiella variicola 342 tRNA-Phe
  5400. Klebsiella variicola At-22 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5401. Klebsiella variicola BIDMC 61 tRNA-Phe
  5402. Klebsiella variicola CAG:634 transfer RNA-Phe(GAA)
  5403. Klebsiella variicola MGH 68 tRNA-Phe
  5404. Klebsiella variicola MGH 76 tRNA-Phe
  5405. Klebsiella variicola MGH 80 tRNA-Phe
  5406. Klebsiella variicola subsp. tropica tRNA-Phe
  5407. Klebsiella variicola subsp. variicola tRNA-Phe(gaa)
  5408. Klebsiella variicola tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5409. Klebsiella variicola UCI 18 tRNA-Phe
  5410. Klebsiella variicola UCICRE 10 tRNA-Phe
  5411. Kluyvera ascorbata ATCC 33433 tRNA-Phe
  5412. Kluyvera ascorbata F0526 tRNA-Phe
  5413. Kluyvera ascorbata tRNA-Phe
  5414. Kluyvera chengduensis tRNA-Phe
  5415. Kluyvera cryocrescens tRNA-Phe(gaa)
  5416. Kluyvera fluvialis tRNA-Phe
  5417. Kluyvera genomosp. 3 tRNA-Phe
  5418. Kluyvera georgiana ATCC 51603 tRNA-Phe
  5419. Kluyvera georgiana tRNA-Phe
  5420. Kluyvera huaxiensis tRNA-Phe
  5421. Kluyvera intermedia tRNA-Phe(gaa)
  5422. [Kluyvera] intestini tRNA-Phe
  5423. Kluyvera sichuanensis tRNA-Phe
  5424. Kluyvera sp. 142486 tRNA-Phe
  5425. Kluyvera sp. Awk 3 tRNA-Phe
  5426. Kluyvera sp. CRP tRNA-Phe
  5427. Kluyvera sp. EC_51 tRNA-Phe
  5428. Kluyvera sp. M-M157-B tRNA-Phe(gaa)
  5429. Kluyvera sp. Nf5 tRNA-Phe
  5430. Kluyvera sp. NPDC087067 tRNA-Phe
  5431. Kluyvera sp. STS39-E tRNA-Phe
  5432. Kluyvera sp. tRNA-Phe
  5433. Kosakonia cowanii tRNA-Phe
  5434. Kosakonia oryzae tRNA-Phe
  5435. Kosakonia oryzendophytica tRNA_Phe_GAA
  5436. Kosakonia oryziphila tRNA_Phe_GAA
  5437. Kosakonia pseudosacchari tRNA-Phe
  5438. Kosakonia radicincitans DSM 16656 tRNA-Phe
  5439. Kosakonia radicincitans tRNA-Phe-GAA
  5440. Kosakonia radicincitans UMEnt01/12 tRNA-Phe
  5441. Kosakonia radicincitans YD4 tRNA-Phe
  5442. Kosakonia sacchari SP1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5443. Kosakonia sacchari tRNA-Phe
  5444. Kosakonia sp. 1610 tRNA-Phe
  5445. Kosakonia beeri Kosakonia sp. BK9b tRNA-Phe
  5446. Kosakonia calanthes Kosakonia sp. BYX6 tRNA-Phe
  5447. Kosakonia sp. CCTCC M2018092 tRNA-Phe
  5448. Kosakonia sp. CFBP8986 tRNA-Phe
  5449. Kosakonia styphnolobii tRNA-Phe
  5450. Kosakonia sp. H7A tRNA-Phe
  5451. Kosakonia sp. HypNH10 tRNA-Phe
  5452. Kosakonia sp. MH5 tRNA-Phe
  5453. Kosakonia sp. ML.JS2a tRNA-Phe
  5454. Kosakonia sp. MUSA4 tRNA-Phe
  5455. Kosakonia sp. PSU_27 tRNA-Phe
  5456. Kosakonia sp. PSU_31 tRNA-Phe
  5457. Kosakonia sp. R1.Fl tRNA-Phe
  5458. Kosakonia sp. S42 tRNA-Phe
  5459. Kosakonia sp. S57 tRNA-Phe
  5460. Kosakonia sp. S58 tRNA-Phe
  5461. Kosakonia sp. SMBL-WEM22 tRNA-Phe
  5462. Kosakonia sp. SOY2 tRNA-Phe
  5463. Kosakonia sp. WA-90 tRNA-Phe
  5464. Kosakonia quasisacchari tRNA-Phe
  5465. Kosakonia sp. YIM B13571 tRNA-Phe
  5466. Kosakonia sp. YIM B13581 tRNA-Phe
  5467. Kosakonia sp. YIM B13588 tRNA-Phe
  5468. Kosakonia sp. YIM B13605 tRNA-Phe
  5469. Kosakonia sp. YIM B13611 tRNA-Phe
  5470. Leclercia adecarboxylata ATCC 23216 = NBRC 102595 tRNA-Phe
  5471. Leclercia adecarboxylata tRNA-Phe
  5472. Leclercia barmai tRNA-Phe
  5473. Leclercia sp. 119287 tRNA-Phe
  5474. Leclercia sp. 1548 tRNA-Phe
  5475. Leclercia sp. 29361 tRNA-Phe
  5476. Leclercia pneumoniae tRNA-Phe
  5477. Leclercia sp. CFBP8987 tRNA-Phe
  5478. Leclercia sp. Colony189 tRNA-Phe
  5479. Leclercia sp. EC_58 tRNA-Phe
  5480. Leclercia sp. G3L tRNA-Phe
  5481. Leclercia sp. GLN_9 tRNA-Phe
  5482. Leclercia sp. J807 tRNA-Phe
  5483. Leclercia sp. LK8 tRNA-Phe
  5484. Leclercia sp. LSNIH1 tRNA-Phe
  5485. Leclercia sp. LSNIH2 tRNA-Phe
  5486. Leclercia sp. LSNIH3 tRNA-Phe
  5487. Leclercia sp. LSNIH4 tRNA-Phe
  5488. Leclercia sp. LSNIH5 tRNA-Phe
  5489. Leclercia sp. LSNIH6 tRNA-Phe
  5490. Leclercia sp. LSNIH7 tRNA-Phe
  5491. Leclercia sp. LSNIH8 tRNA-Phe
  5492. Leclercia sp. LTM01 tRNA-Phe
  5493. Leclercia sp. LTM14 tRNA-Phe
  5494. Leclercia sp. M-A074-M tRNA-Phe(gaa)
  5495. Leclercia sp. S52 tRNA-Phe
  5496. Leclercia sp. TB492 tRNA-Phe
  5497. Leclercia sp. (terrestrial metagenome) tRNA-Phe
  5498. Leclercia sp. W17 tRNA-Phe
  5499. Leclercia sp. W6 tRNA-Phe
  5500. Leclercia tamurae tRNA-Phe
  5501. Lelliottia amnigena CHS 78 tRNA-Phe
  5502. Lelliottia amnigena tRNA-Phe
  5503. Lelliottia aquatilis tRNA-Phe
  5504. Lelliottia jeotgali tRNA-Phe(gaa)
  5505. Lelliottia nimipressuralis tRNA-Phe(gaa)
  5506. Lelliottia sp. 489 tRNA-Phe
  5507. Lelliottia sp. 7254-16 tRNA-Phe
  5508. Lelliottia sp. AC1 tRNA-Phe
  5509. Lelliottia sp. CFBP8978 tRNA-Phe
  5510. Lelliottia sp. EB106-05-01-XG201 tRNA-Phe
  5511. Lelliottia sp. F153 tRNA-Phe
  5512. Lelliottia sp. F154 tRNA-Phe
  5513. Lelliottia sp. F159 tRNA-Phe
  5514. Lelliottia sp. GFLA7 tRNA-Phe
  5515. Lelliottia sp. RWM.1 tRNA-Phe
  5516. Lelliottia sp. SL45 tRNA-Phe
  5517. Lelliottia sp. T2.26D-8 tRNA-Phe(gaa)
  5518. Lelliottia sp. tRNA-Phe
  5519. Lelliottia wanjuensis Lelliottia sp. V104_15 tRNA-Phe
  5520. Lelliottia wanjuensis Lelliottia sp. V106_10 tRNA-Phe
  5521. Lelliottia wanjuensis Lelliottia sp. V106_12 tRNA-Phe
  5522. Lelliottia wanjuensis Lelliottia sp. V106_16 tRNA-Phe
  5523. Lelliottia wanjuensis Lelliottia sp. V106_5 tRNA-Phe
  5524. Lelliottia wanjuensis Lelliottia sp. V106_9 tRNA-Phe
  5525. Lelliottia wanjuensis Lelliottia sp. V86_10 tRNA-Phe
  5526. Lelliottia wanjuensis Lelliottia sp. V89_10 tRNA-Phe
  5527. Lelliottia wanjuensis tRNA-Phe
  5528. Lelliottia wanjuensis Lelliottia sp. V89_5 tRNA-Phe
  5529. Lelliottia sp. WB101 tRNA-Phe
  5530. Leminorella grimontii ATCC 33999 = DSM 5078 tRNA-Phe
  5531. Leminorella grimontii tRNA-Phe(gaa)
  5532. Leminorella richardii tRNA-Phe(gaa)
  5533. Limnobaculum allomyrinae tRNA-Phe
  5534. Limnobaculum eriocheiris tRNA-Phe
  5535. Limnobaculum parvum tRNA-Phe
  5536. Limnobaculum sp. M2-1 tRNA-Phe
  5537. Limnobaculum xujianqingii tRNA-Phe
  5538. Listeria monocytogenes tRNA-Phe
  5539. Lonsdalea britannica tRNA-Phe
  5540. Lonsdalea iberica tRNA-Phe
  5541. Lonsdalea populi tRNA-Phe
  5542. Lonsdalea quercina tRNA-Phe
  5543. Mangrovibacter phragmitis tRNA-Phe
  5544. Mangrovibacter sp. MFB070 tRNA-Phe
  5545. Mangrovibacter sp. SLW1 tRNA-Phe
  5546. Mesorhizobium sp. tRNA-Phe
  5547. Phytobacter massiliensis tRNA-Phe(gaa)
  5548. Phytobacter sp. (rhizosphere metagenome) tRNA-Phe
  5549. Microbacterium koreense tRNA-Phe
  5550. Microbacterium sp. SUBG005 tRNA-Phe
  5551. Mixta calida tRNA-Phe
  5552. Mixta gaviniae tRNA-Phe
  5553. Mixta intestinalis tRNA-Phe
  5554. Mixta sp. BE291 tRNA-Phe
  5555. Mixta tenebrionis tRNA-Phe
  5556. Mixta sp. tRNA-Phe
  5557. Mixta hanseatica tRNA-Phe
  5558. Mixta theicola tRNA-Phe
  5559. Moellerella wisconsensis ATCC 35017 tRNA-Phe
  5560. Moellerella wisconsensis tRNA-Phe(gaa)
  5561. Mogibacterium sp. tRNA-Phe
  5562. Morganella morganii tRNA-Phe
  5563. Morganella morganii subsp. intermedius tRNA-Phe
  5564. Morganella morganii subsp. morganii KT tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5565. Morganella morganii subsp. morganii tRNA-Phe
  5566. Morganella morganii subsp. sibonii tRNA-Phe
  5567. Morganella sp. B601 tRNA-Phe
  5568. Morganella sp. EGD-HP17 tRNA-Phe
  5569. Morganella sp. GD04133 tRNA-Phe
  5570. Morganella sp. HMSC11D09 tRNA-Phe
  5571. Morganella sp. HSTU-ASny43 tRNA-Phe
  5572. Morganella sp. (in: enterobacteria) tRNA-Phe
  5573. Morganella sp. Je.2.23 tRNA-Phe
  5574. Morganella sp. TYF_1 tRNA-Phe
  5575. Morganella sp. TYF_4 tRNA-Phe
  5576. Morganella sp. TYF_6 tRNA-Phe
  5577. Morganella sp. YQ_12 tRNA-Phe
  5578. Morganella sp. YQ_1 tRNA-Phe
  5579. Morganella sp. YQ_2 tRNA-Phe
  5580. Musicola paradisiaca Ech703 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5581. Musicola paradisiaca tRNA-Phe
  5582. Mycobacterium tuberculosis tRNA-Phe(gaa)
  5583. Nissabacter archeti tRNA-Phe
  5584. Nissabacter sp. SGAir0207 tRNA-Phe
  5585. Nocardioides hankookensis tRNA-Phe
  5586. Obesumbacterium proteus ATCC 12841 tRNA-Phe
  5587. Obesumbacterium proteus tRNA-Phe
  5588. Orbaceae bacterium ac157xtp tRNA-Phe
  5589. Orbaceae bacterium ESL0721 tRNA-Phe
  5590. Pantoea agglomerans tRNA-Phe
  5591. Pantoea alhagi tRNA-Phe
  5592. Mixta calida B021323 tRNA-Phe
  5593. Pantoea dispersa tRNA-Phe
  5594. Pantoea sp. Ap-959 tRNA-Phe
  5595. Pantoea sp. B65 tRNA-Phe
  5596. Pantoea sp. FN0302 tRNA-Phe
  5597. Pantoea sp. FN0305 tRNA-Phe
  5598. Pantoea sp. FN0307 tRNA-Phe
  5599. Pantoea sp. FN060301 tRNA-Phe
  5600. Pantoea sp. ICBG 828 tRNA-Phe
  5601. [Pantoea] beijingensis tRNA-Phe
  5602. Pantoea sp. LS15 tRNA-Phe
  5603. Pantoea sp. MBD-2R tRNA-Phe
  5604. Pantoea sp. PSNIH2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5605. Pantoea sp. PSNIH3 tRNA-Phe
  5606. Pantoea sp. PSNIH4 tRNA-Phe
  5607. Pantoea sp. PSNIH5 tRNA-Phe
  5608. Pantoea sp. tRNA-Phe
  5609. Pectobacterium carotovorum subsp. carotovorum UGC32 tRNA-Phe
  5610. Pectobacterium peruviense tRNA-Phe
  5611. Pedobacter himalayensis tRNA-Phe
  5612. Mycolicibacterium smegmatis MC2 155 pe/E deacylated phenylanaline-tRNA from Mycolicibacterium smegmatis MC2 155 (PDB 8V9J, chain y)
  5613. Pelagerythrobacter marinus tRNA-Phe
  5614. Phytobacter diazotrophicus tRNA-Phe(gaa)
  5615. Phytobacter palmae tRNA-Phe
  5616. Phytobacter sp. MRY16-398 tRNA-Phe
  5617. Phytobacter sp. tRNA-Phe
  5618. Phytobacter ursingii tRNA-Phe
  5619. Pluralibacter gergoviae tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  5620. Pluralibacter sp. S10_ASV_43 tRNA-Phe
  5621. Pluralibacter sp. S54_ASV_43 tRNA-Phe
  5622. Pluralibacter sp. tRNA-Phe
  5623. Pragia fontium DSM 5563 = ATCC 49100 tRNA_Phe_GAA
  5624. Pragia fontium tRNA-Phe
  5625. Limnobaculum zhutongyuii tRNA-Phe
  5626. Limnobaculum zhutongyuii Pragia sp. CF-917 tRNA-Phe
  5627. Proteus hauseri ATCC 700826 tRNA-Phe
  5628. Proteus hauseri tRNA-Phe
  5629. Proteus mirabilis ATCC 29906 tRNA-Phe
  5630. Proteus mirabilis BB2000 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5631. Proteus mirabilis HI4320 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5632. Proteus mirabilis tRNA-Phe
  5633. Proteus mirabilis WGLW4 tRNA-Phe
  5634. Proteus mirabilis WGLW6 tRNA-Phe
  5635. Proteus sp. G2609 tRNA-Phe
  5636. Proteus sp. G2638 tRNA-Phe
  5637. Proteus sp. G2674 tRNA-Phe
  5638. Proteus sp. G2675 tRNA-Phe
  5639. Proteus sp. G3927 tRNA-Phe
  5640. Proteus sp. G4377 tRNA-Phe
  5641. Proteus sp. G4378 tRNA-Phe
  5642. Proteus sp. G4379 tRNA-Phe
  5643. Proteus sp. G4380 tRNA-Phe
  5644. Proteus sp. G4389 tRNA-Phe
  5645. Proteus sp. G4390 tRNA-Phe
  5646. Proteus sp. G4398 tRNA-Phe
  5647. Proteus sp. G4399 tRNA-Phe
  5648. Proteus sp. G4400 tRNA-Phe
  5649. Proteus sp. G4404 tRNA-Phe
  5650. Proteus sp. G4406 tRNA-Phe
  5651. Proteus sp. G4408 tRNA-Phe
  5652. Proteus sp. G4412 tRNA-Phe
  5653. Proteus sp. G4415 tRNA-Phe
  5654. Proteus sp. G4417 tRNA-Phe
  5655. Proteus sp. G4419 tRNA-Phe
  5656. Proteus sp. G4441 tRNA-Phe
  5657. Proteus sp. G4444 tRNA-Phe
  5658. Proteus sp. G4445 tRNA-Phe
  5659. Proteus sp. G4463 tRNA-Phe
  5660. Proteus sp. G4465 tRNA-Phe
  5661. Proteus sp. G4468 tRNA-Phe
  5662. Proteus sp. HMSC10D02 tRNA-Phe
  5663. Proteus sp. HMSC14B05 tRNA-Phe
  5664. Proteus sp. MB838 tRNA-Phe
  5665. Providencia alcalifaciens 205/92 tRNA-Phe
  5666. Providencia alcalifaciens Dmel2 tRNA-Phe
  5667. Providencia alcalifaciens DSM 30120 tRNA-Phe
  5668. Providencia alcalifaciens F90-2004 tRNA-Phe
  5669. Providencia alcalifaciens PAL-1 tRNA-Phe
  5670. Providencia alcalifaciens PAL-2 tRNA-Phe
  5671. Providencia alcalifaciens PAL-3 tRNA-Phe
  5672. Providencia alcalifaciens R90-1475 tRNA-Phe
  5673. Providencia alcalifaciens RIMD 1656011 tRNA-Phe
  5674. Providencia alcalifaciens tRNA-Phe(gaa)
  5675. Providencia burhodogranariea DSM 19968 tRNA-Phe
  5676. Providencia hangzhouensis tRNA-Phe
  5677. Providencia heimbachae ATCC 35613 tRNA-Phe
  5678. Providencia heimbachae tRNA-Phe(gaa)
  5679. Providencia huashanensis tRNA-Phe
  5680. Providencia huaxiensis tRNA-Phe
  5681. Providencia lanzhouensis tRNA-Phe
  5682. Providencia manganoxydans tRNA-Phe
  5683. Providencia pseudovermicola tRNA-Phe
  5684. Providencia rettgeri Dmel1 tRNA-Phe
  5685. Providencia rettgeri DSM 1131 tRNA-Phe
  5686. Providencia rettgeri tRNA-Phe(gaa)
  5687. Providencia rustigianii DSM 4541 tRNA-Phe
  5688. Providencia rustigianii tRNA-Phe
  5689. Providencia sneebia DSM 19967 tRNA-Phe
  5690. Providencia sp. 1701011 tRNA-Phe
  5691. Providencia sp. 1701091 tRNA-Phe
  5692. Providencia sp. 1709051003 tRNA-Phe
  5693. Providencia sp. 2023EL-00965 tRNA-Phe
  5694. Providencia sp. 2024EL-00606 tRNA-Phe
  5695. Providencia sp. 2024EL-00732 tRNA-Phe
  5696. Providencia sp. 2024EL-00811 tRNA-Phe
  5697. Providencia sp. 21OH12SH02B-Prov tRNA-Phe
  5698. Providencia sp. 2.29 tRNA-Phe
  5699. Providencia sp. 504mA tRNA-Phe
  5700. Providencia sp. AGC89 tRNA-Phe
  5701. Providencia sp. B1 tRNA-Phe
  5702. Providencia sp. B2 tRNA-Phe
  5703. Providencia sp. B3 tRNA-Phe
  5704. Providencia sp. CIM-Carb-044 tRNA-Phe
  5705. Providencia huashanensis tRNA-Phe
  5706. Providencia huashanensis tRNA-Phe
  5707. Providencia zhijiangensis Providencia sp. D4759 tRNA-Phe
  5708. Providencia pseudovermicola Providencia sp. DFU6 tRNA-Phe
  5709. Providencia sp. Je.9.19 tRNA-Phe
  5710. Providencia sp. JGM172 tRNA-Phe
  5711. Providencia sp. JGM178 tRNA-Phe
  5712. Providencia sp. JGM181 tRNA-Phe
  5713. Providencia sp. JUb39 tRNA-Phe
  5714. Providencia sp. KP2202517 tRNA-Phe
  5715. Providencia sp. LR1 tRNA-Phe
  5716. Providencia sp. LY12 tRNA-Phe
  5717. Providencia sp. Me1 tRNA-Phe
  5718. Providencia sp. Me31A tRNA-Phe
  5719. Providencia sp. MGF014 tRNA-Phe
  5720. Providencia sp. NPDC089768 tRNA-Phe
  5721. Providencia sp. NPDC089923 tRNA-Phe
  5722. Providencia sp. NPDC089930 tRNA-Phe
  5723. Providencia sp. NPDC089933 tRNA-Phe
  5724. Providencia sp. PROV004 tRNA-Phe
  5725. Providencia sp. PROV012 tRNA-Phe
  5726. Providencia sp. PROV_01 tRNA-Phe
  5727. Providencia sp. PROV024 tRNA-Phe
  5728. Providencia sp. PROV040 tRNA-Phe
  5729. Providencia sp. PROV046 tRNA-Phe
  5730. Providencia sp. PROV061 tRNA-Phe
  5731. Providencia sp. PROV099 tRNA-Phe
  5732. Providencia sp. PROV114 tRNA-Phe
  5733. Providencia sp. PROV170 tRNA-Phe
  5734. Providencia sp. PROV175 tRNA-Phe
  5735. Providencia sp. PROV188 tRNA-Phe
  5736. Providencia sp. R1 tRNA-Phe
  5737. Providencia sp. R2 tRNA-Phe
  5738. Providencia sp. R33 tRNA-Phe
  5739. Providencia sp. R3 tRNA-Phe
  5740. Providencia xihuensis Providencia sp. SKLX074055 tRNA-Phe
  5741. Providencia zhejiangensis Providencia sp. SKLX146130 tRNA-Phe
  5742. Providencia sp. SP181 tRNA-Phe
  5743. Providencia sp. T47 tRNA-Phe
  5744. Providencia sp. tRNA-Phe(gaa)
  5745. Providencia sp. TYF_10 tRNA-Phe
  5746. Providencia sp. TYF-12 tRNA-Phe
  5747. Providencia sp. VP23HZSY-1 tRNA-Phe
  5748. Providencia sp. wls1914 tRNA-Phe
  5749. Providencia sp. wls1916 tRNA-Phe
  5750. Providencia sp. wls1919 tRNA-Phe
  5751. Providencia sp. wls1921 tRNA-Phe
  5752. Providencia sp. wls1938 tRNA-Phe
  5753. Providencia sp. wls1943 tRNA-Phe
  5754. Providencia sp. wls1948 tRNA-Phe
  5755. Providencia sp. wls1949 tRNA-Phe
  5756. Providencia sp. wls1950 tRNA-Phe
  5757. Providencia stuartii MRSN 2154 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5758. Providencia stuartii tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5759. Providencia stuartii tRNA-Phe
  5760. Providencia vermicola tRNA-Phe
  5761. Pseudenterobacter timonensis tRNA-Phe
  5762. Pseudescherichia sp. L3 tRNA-Phe
  5763. Pseudescherichia vulneris tRNA-Phe(gaa)
  5764. Pseudocitrobacter corydidari tRNA-Phe
  5765. Pseudocitrobacter cyperus tRNA-Phe
  5766. Pseudocitrobacter faecalis tRNA-Phe
  5767. Pseudocitrobacter sp. 2023EL-00150 tRNA-Phe
  5768. Pseudocitrobacter sp. 73 tRNA-Phe
  5769. Pseudocitrobacter sp. MW920760 tRNA-Phe
  5770. Pseudocitrobacter vendiensis tRNA-Phe
  5771. Pseudomonadota bacterium tRNA-Phe
  5772. Pseudomonas aeruginosa tRNA-Phe
  5773. Pseudomonas lundensis tRNA-Phe
  5774. Pseudomonas reactans tRNA-Phe
  5775. Pseudomonas sp. PAH14 tRNA-Phe
  5776. Pseudomonas sp. SWRI144 tRNA-Phe
  5777. Pseudomonas tritici tRNA-Phe
  5778. synthetic construct P-SITE RNA ASL-PHE from synthetic construct (PDB 4V5A, chain AV)
  5779. Oryctolagus cuniculus P-site tRNA from Oryctolagus cuniculus (PDB 7MDZ, chain 2)
  5780. Klebsiella ornithinolytica 10-5246 tRNA-Phe
  5781. Klebsiella ornithinolytica 2-156-04_S1_C1 tRNA-Phe
  5782. Klebsiella ornithinolytica 2-156-04_S1_C2 tRNA-Phe
  5783. Klebsiella ornithinolytica CD1_MRS_4 tRNA-Phe
  5784. Klebsiella planticola ATCC 33531 tRNA-Phe
  5785. Klebsiella sp. 10-1 tRNA-Phe
  5786. Klebsiella sp. Lac1 tRNA-Phe
  5787. Klebsiella sp. Lac2 tRNA-Phe
  5788. Raoultella sp. tRNA-Phe
  5789. Klebsiella sp. NCTC 9187 tRNA-Phe(gaa)
  5790. Klebsiella sp. R2A007 Raoultella sp. R2A007 tRNA-Phe
  5791. Klebsiella sp. RIT712 tRNA-Phe
  5792. Klebsiella sp. RLT01 tRNA-Phe
  5793. Raoultella sp. T31 tRNA-Phe
  5794. Klebsiella scottii Raoultella sp. Txe2.2 tRNA-Phe
  5795. Klebsiella scottii Raoultella sp. WB_B2P2-3 tRNA-Phe
  5796. Klebsiella sp. X13 tRNA-Phe
  5797. Klebsiella sp. XY-1 tRNA-Phe
  5798. rhizosphere metagenome tRNA
  5799. Rouxiella aceris tRNA-Phe
  5800. Rouxiella badensis subsp. acadiensis tRNA-Phe
  5801. Rouxiella badensis tRNA-Phe
  5802. Rouxiella chamberiensis tRNA-Phe
  5803. Rouxiella sp. Mn2063 tRNA-Phe
  5804. Rouxiella sp. T17 tRNA-Phe
  5805. Rouxiella sp. WC2420 tRNA-Phe
  5806. Salmonella bongori CFSAN000509 tRNA-Phe
  5807. Salmonella bongori CFSAN000510 tRNA-Phe
  5808. Salmonella bongori N268-08 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5809. Salmonella bongori NCTC 12419 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5810. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Phe
  5811. Salmonella bongori serovar 40:z35:- tRNA-Phe
  5812. Salmonella bongori serovar 44:r:- tRNA-Phe
  5813. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Phe
  5814. Salmonella bongori serovar 48:i:- tRNA-Phe
  5815. Salmonella bongori serovar 48:z35:- tRNA-Phe
  5816. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5817. Salmonella bongori serovar 48:z81:- tRNA-Phe
  5818. Salmonella bongori serovar 66:z39:- tRNA-Phe
  5819. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Phe
  5820. Salmonella bongori serovar 66:z65:- tRNA-Phe
  5821. Salmonella bongori transfer RNA-Phe
  5822. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Phe
  5823. Salmonella enterica subsp. arizonae serovar 1,13,23:g,z51:- tRNA-Phe
  5824. Salmonella enterica subsp. arizonae serovar 13,22:z4,z23:- tRNA-Phe
  5825. Salmonella enterica subsp. arizonae serovar 13,23:g,z51:- tRNA-Phe
  5826. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32450 tRNA-Phe
  5827. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32457 tRNA-Phe
  5828. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43478 tRNA-Phe
  5829. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43479 tRNA-Phe
  5830. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43480 tRNA-Phe
  5831. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43481 tRNA-Phe
  5832. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43482 tRNA-Phe
  5833. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18383 tRNA-Phe
  5834. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18503 tRNA-Phe
  5835. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18554 tRNA-Phe
  5836. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N20028 tRNA-Phe
  5837. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Phe
  5838. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N25373 tRNA-Phe
  5839. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26624 tRNA-Phe
  5840. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26625 tRNA-Phe
  5841. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26626 tRNA-Phe
  5842. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26928 tRNA-Phe
  5843. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N27 tRNA-Phe
  5844. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N29354 tRNA-Phe
  5845. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N31597 tRNA-Phe
  5846. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N4410 tRNA-Phe
  5847. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N5 tRNA-Phe
  5848. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N6509 tRNA-Phe
  5849. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Phe
  5850. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N9135 tRNA-Phe
  5851. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Phe
  5852. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Phe
  5853. Salmonella enterica subsp. arizonae serovar 21:z4,z23:- tRNA-Phe
  5854. Salmonella enterica subsp. arizonae serovar 35:z4,z32:- tRNA-Phe
  5855. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Phe
  5856. Salmonella enterica subsp. arizonae serovar 40:z36:- tRNA-Phe
  5857. Salmonella enterica subsp. arizonae serovar 40:z4,z23:- tRNA-Phe
  5858. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Phe
  5859. Salmonella enterica subsp. arizonae serovar 40:z4,z32:- tRNA-Phe
  5860. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- str. 01-0089 tRNA-Phe
  5861. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Phe
  5862. Salmonella enterica subsp. arizonae serovar 41:z4,z32:- tRNA-Phe
  5863. Salmonella enterica subsp. arizonae serovar 42:z4,z24:- tRNA-Phe
  5864. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Phe
  5865. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Phe
  5866. Salmonella enterica subsp. arizonae serovar 48:z4,z23:- tRNA-Phe
  5867. Salmonella enterica subsp. arizonae serovar 48:z4,z23,z32:- tRNA-Phe
  5868. Salmonella enterica subsp. arizonae serovar 48:z4,z24:- tRNA-Phe
  5869. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Phe
  5870. Salmonella enterica subsp. arizonae serovar 50:z4,z23:- tRNA-Phe
  5871. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Phe
  5872. Salmonella enterica subsp. arizonae serovar 51:z4,z23:- tRNA-Phe
  5873. Salmonella enterica subsp. arizonae serovar 53:-:- str. SA20100345 tRNA-Phe
  5874. Salmonella enterica subsp. arizonae serovar 53:z4,z23:- tRNA-Phe
  5875. Salmonella enterica subsp. arizonae serovar 53:z4,z23,z32:- tRNA-Phe
  5876. Salmonella enterica subsp. arizonae serovar 53:z4,z24:- tRNA-Phe
  5877. Salmonella enterica subsp. arizonae serovar 56:z36:- tRNA-Phe
  5878. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Phe
  5879. Salmonella enterica subsp. arizonae serovar 62:z36:- str. 5335/86 tRNA-Phe
  5880. Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5881. Salmonella enterica subsp. arizonae serovar 62:z36:- tRNA-Phe
  5882. Salmonella enterica subsp. arizonae serovar 62:z4,z23:- tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  5883. Salmonella enterica subsp. arizonae serovar 62:z4,z32:- tRNA-Phe
  5884. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Phe
  5885. Salmonella enterica subsp. arizonae serovar 63:g,z51:- tRNA-Phe
  5886. Salmonella enterica subsp. arizonae serovar 63:z4,z23:- tRNA-Phe
  5887. Salmonella enterica subsp. arizonae serovar 6,7:g,z51:- tRNA-Phe
  5888. Salmonella enterica subsp. arizonae serovar -:z4,z24:- tRNA-Phe
  5889. Salmonella enterica subsp. arizonae str. CFSAN000560 tRNA-Phe
  5890. Salmonella enterica subsp. arizonae str. CFSAN000561 tRNA-Phe
  5891. Salmonella enterica subsp. arizonae tRNA-Phe(gaa)
  5892. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Phe
  5893. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Phe
  5894. Salmonella enterica subsp. diarizonae serovar 17:z10:e,n,x,z15 tRNA-Phe
  5895. Salmonella enterica subsp. diarizonae serovar 18:I,v:z tRNA-Phe
  5896. Salmonella enterica subsp. diarizonae serovar 21:z10:e,n,x,z15 tRNA-Phe
  5897. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Phe
  5898. Salmonella enterica subsp. diarizonae serovar 35:l,v:z35 tRNA-Phe
  5899. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Phe
  5900. Salmonella enterica subsp. diarizonae serovar 38:(k):z35 tRNA-Phe
  5901. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Phe
  5902. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Phe
  5903. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Phe
  5904. Salmonella enterica subsp. diarizonae serovar 38:l,v:z13:z53 tRNA-Phe
  5905. Salmonella enterica subsp. diarizonae serovar 42:l,v:1,5,7 tRNA-Phe
  5906. Salmonella enterica subsp. diarizonae serovar 47:i:z53 tRNA-Phe
  5907. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Phe
  5908. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Phe
  5909. Salmonella enterica subsp. diarizonae serovar 48:i:z35 tRNA-Phe
  5910. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Phe
  5911. Salmonella enterica subsp. diarizonae serovar 48:k:- tRNA-Phe
  5912. Salmonella enterica subsp. diarizonae serovar 48:k:z35 tRNA-Phe
  5913. Salmonella enterica subsp. diarizonae serovar 48:k:z53 tRNA-Phe
  5914. Salmonella enterica subsp. diarizonae serovar 48:r:z tRNA-Phe
  5915. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Phe
  5916. Salmonella enterica subsp. diarizonae serovar 50:k:z35 tRNA-Phe
  5917. Salmonella enterica subsp. diarizonae serovar 50:k:z53 tRNA-Phe
  5918. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Phe
  5919. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Phe
  5920. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Phe
  5921. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Phe
  5922. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Phe
  5923. Salmonella enterica subsp. diarizonae serovar 50:z35:z35 tRNA-Phe
  5924. Salmonella enterica subsp. diarizonae serovar 50:z52:z35 tRNA-Phe
  5925. Salmonella enterica subsp. diarizonae serovar 50:z:- tRNA-Phe
  5926. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Phe
  5927. Salmonella enterica subsp. diarizonae serovar 53:k:e,n,x,z15 tRNA-Phe
  5928. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Phe
  5929. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Phe
  5930. Salmonella enterica subsp. diarizonae serovar 53:z10:z35 tRNA-Phe
  5931. Salmonella enterica subsp. diarizonae serovar 53:z10:z tRNA-Phe
  5932. Salmonella enterica subsp. diarizonae serovar 57:c:e,n,x,z15 tRNA-Phe
  5933. Salmonella enterica subsp. diarizonae serovar 57:c:z tRNA-Phe
  5934. Salmonella enterica subsp. diarizonae serovar 57:k:e,n,x,z15 tRNA-Phe
  5935. Salmonella enterica subsp. diarizonae serovar 58:r:z53 tRNA-Phe
  5936. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Phe
  5937. Salmonella enterica subsp. diarizonae serovar 60-67:z35:- tRNA-Phe
  5938. Salmonella enterica subsp. diarizonae serovar 60:k:z tRNA-Phe
  5939. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Phe
  5940. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Phe
  5941. Salmonella enterica subsp. diarizonae serovar 60:r:z tRNA-Phe
  5942. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Phe
  5943. Salmonella enterica subsp. diarizonae serovar (6),14:z10:z tRNA-Phe
  5944. Salmonella enterica subsp. diarizonae serovar 61:c:z35 tRNA-Phe
  5945. Salmonella enterica subsp. diarizonae serovar 61:i:z53 tRNA-Phe
  5946. Salmonella enterica subsp. diarizonae serovar 61:i:z tRNA-Phe
  5947. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Phe
  5948. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Phe
  5949. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,[7] tRNA-Phe
  5950. Salmonella enterica subsp. diarizonae serovar 61:k:1,5 tRNA-Phe
  5951. Salmonella enterica subsp. diarizonae serovar 61:k:z35 tRNA-Phe
  5952. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Phe
  5953. Salmonella enterica subsp. diarizonae serovar 61:l,v(z13):1,5,7 tRNA-Phe
  5954. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Phe
  5955. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Phe
  5956. Salmonella enterica subsp. diarizonae serovar 61:q,v:z35 tRNA-Phe
  5957. Salmonella enterica subsp. diarizonae serovar 61:r:- tRNA-Phe
  5958. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Phe
  5959. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Phe
  5960. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Phe
  5961. Salmonella enterica subsp. diarizonae serovar 61:z52-z57:- tRNA-Phe
  5962. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Phe
  5963. Salmonella enterica subsp. diarizonae serovar 65:(k):z subsp. diarizonae serovar 65:(k):z tRNA-Phe
  5964. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Phe
  5965. Salmonella enterica subsp. diarizonae serovar 6,7,14:k:z50 tRNA-Phe
  5966. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Phe
  5967. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Phe
  5968. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Phe
  5969. Salmonella enterica subsp. diarizonae serovar -:z10:- tRNA-Phe
  5970. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Phe
  5971. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Phe
  5972. Salmonella enterica subsp. diarizonae tRNA-Phe(gaa)
  5973. Salmonella enterica subsp. enterica serovar 11:b:1,7 tRNA-Phe
  5974. Salmonella enterica subsp. enterica serovar 11:r:- tRNA-Phe
  5975. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Phe
  5976. Salmonella enterica subsp. enterica serovar 13,22:y:- tRNA-Phe
  5977. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Phe
  5978. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Phe
  5979. Salmonella enterica subsp. enterica serovar 13,23:-:- tRNA-Phe
  5980. Salmonella enterica subsp. enterica serovar 13,23:y:e,n,z15 tRNA-Phe
  5981. Salmonella enterica subsp. enterica serovar 13:d:e,n,x tRNA-Phe
  5982. Salmonella enterica subsp. enterica serovar 13:i:1,5 tRNA-Phe
  5983. Salmonella enterica subsp. enterica serovar 1,4,12,27:b:- tRNA-Phe
  5984. Salmonella enterica subsp. enterica serovar 1,4,12:i:- tRNA-Phe
  5985. Salmonella enterica subsp. enterica serovar 1,4,[5],12:b:- tRNA-Phe
  5986. Salmonella enterica subsp. enterica serovar 1,4,5,12:b:- tRNA-Phe
  5987. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Phe
  5988. Salmonella enterica subsp. enterica serovar 1,4,5,12:i:- tRNA-Phe
  5989. Salmonella enterica subsp. enterica serovar 14:z:e,n,x tRNA-Phe
  5990. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Phe
  5991. Salmonella enterica subsp. enterica serovar 16:l,v:- 2 tRNA-Phe
  5992. Salmonella enterica subsp. enterica serovar 16:l,v:- tRNA-Phe
  5993. Salmonella enterica subsp. enterica serovar 18:-:- tRNA-Phe
  5994. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Phe
  5995. Salmonella enterica subsp. enterica serovar 2,12:-:1,5 tRNA-Phe
  5996. Salmonella enterica subsp. enterica serovar 28:e,h:z6 tRNA-Phe
  5997. Salmonella enterica subsp. enterica serovar 30:e,h:- tRNA-Phe
  5998. Salmonella enterica subsp. enterica serovar 3,10[15][15,34]:e,h:- tRNA-Phe
  5999. Salmonella enterica subsp. enterica serovar 3,[10],[15]:r:- tRNA-Phe
  6000. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Phe
  6001. Salmonella enterica subsp. enterica serovar 3,10:l,z13,z28:l,w tRNA-Phe
  6002. Salmonella enterica subsp. enterica serovar 3,10:-:- tRNA-Phe
  6003. Salmonella enterica subsp. enterica serovar 3,10:z10:- tRNA-Phe
  6004. Salmonella enterica subsp. enterica serovar 3,[15],[15,34]:-:- tRNA-Phe
  6005. Salmonella enterica subsp. enterica serovar 3:e,h:1,6 tRNA-Phe
  6006. Salmonella enterica subsp. enterica serovar 40:-:1,5 tRNA-Phe
  6007. Salmonella enterica subsp. enterica serovar 40:f,g:e,n,x tRNA-Phe
  6008. Salmonella enterica subsp. enterica serovar 4,12:b:- tRNA-Phe
  6009. Salmonella enterica subsp. enterica serovar 4,12:d:- serovar 4,12:d:- tRNA-Phe
  6010. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Phe
  6011. Salmonella enterica subsp. enterica serovar 4,12:nonmotile tRNA-Phe
  6012. Salmonella enterica subsp. enterica serovar 4,12:r:- tRNA-Phe
  6013. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Phe
  6014. Salmonella enterica subsp. enterica serovar 4,12:- tRNA-Phe
  6015. Salmonella enterica subsp. enterica serovar 4,12:-:- tRNA-Phe
  6016. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Phe
  6017. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Phe
  6018. Salmonella enterica subsp. enterica serovar 44:z4,z24:- tRNA-Phe
  6019. Salmonella enterica subsp. enterica serovar 4,[5],12,[27]:-:1,2 tRNA-Phe
  6020. Salmonella enterica subsp. enterica serovar 4,[5],12,[27]:d:- tRNA-Phe
  6021. Salmonella enterica subsp. enterica serovar 4,[5],12,[27]:e,h:- tRNA-Phe
  6022. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Phe
  6023. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Phe
  6024. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Phe
  6025. Salmonella enterica subsp. enterica serovar 4,5,12:b:- var. L(+) tartrate + tRNA-Phe
  6026. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Phe
  6027. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Phe
  6028. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6029. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Phe
  6030. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Phe
  6031. Salmonella enterica subsp. enterica serovar 4,[5],12:i tRNA-Phe
  6032. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- subsp. enterica serovar 4,[5],12:i:- tRNA-Phe
  6033. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Phe
  6034. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Phe
  6035. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Phe
  6036. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Phe
  6037. Salmonella enterica subsp. enterica serovar 4,5,12:r:- tRNA-Phe
  6038. Salmonella enterica subsp. enterica serovar 4,[5],12:- tRNA-Phe
  6039. Salmonella enterica subsp. enterica serovar 4,5,12:-:- tRNA-Phe
  6040. Salmonella enterica subsp. enterica serovar 45:b:- tRNA-Phe
  6041. Salmonella enterica subsp. enterica serovar 4,5:i:1,2 tRNA-Phe
  6042. Salmonella enterica subsp. enterica serovar 4,5:i:- tRNA-Phe
  6043. Salmonella enterica subsp. enterica serovar 47:z4,z23:- tRNA-Phe
  6044. Salmonella enterica subsp. enterica serovar 4:a:- tRNA-Phe
  6045. Salmonella enterica subsp. enterica serovar 4:b:- tRNA-Phe
  6046. Salmonella enterica subsp. enterica serovar - 4:d:1,7 Salmonella enterica subsp. enterica serovar -4:d:1,7 tRNA-Phe
  6047. Salmonella enterica subsp. enterica serovar 4:i:- tRNA-Phe
  6048. Salmonella enterica subsp. enterica serovar 50:k:e,n,x,z15 tRNA-Phe
  6049. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Phe
  6050. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Phe
  6051. Salmonella enterica subsp. enterica serovar 61:-:1,5 tRNA-Phe
  6052. Salmonella enterica subsp. enterica serovar 6,14:a:1,7 tRNA-Phe
  6053. Salmonella enterica subsp. enterica serovar 6,14:r:1,5 tRNA-Phe
  6054. Salmonella enterica subsp. enterica serovar 6,14:-:- tRNA-Phe
  6055. Salmonella enterica subsp. enterica serovar 6,14:y:1,7 tRNA-Phe
  6056. Salmonella enterica subsp. enterica serovar 6,14:z:e,n,x tRNA-Phe
  6057. Salmonella enterica subsp. enterica serovar 61:l,v:1,5 tRNA-Phe
  6058. Salmonella enterica subsp. enterica serovar 6,7,[14]:-:1,5 tRNA-Phe
  6059. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Phe
  6060. Salmonella enterica subsp. enterica serovar 6,7,14:k:- tRNA-Phe
  6061. Salmonella enterica subsp. enterica serovar 6,7,[14]:r:- tRNA-Phe
  6062. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Phe
  6063. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Phe
  6064. Salmonella enterica subsp. enterica serovar 6,7:a:- tRNA-Phe
  6065. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Phe
  6066. Salmonella enterica subsp. enterica serovar 6,7:c:- tRNA-Phe
  6067. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Phe
  6068. Salmonella enterica subsp. enterica serovar 6,7:k:- tRNA-Phe
  6069. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Phe
  6070. Salmonella enterica subsp. enterica serovar 6,7:-:l,w tRNA-Phe
  6071. Salmonella enterica subsp. enterica serovar 6,7:r:- tRNA-Phe
  6072. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Phe
  6073. Salmonella enterica subsp. enterica serovar 6,7:y:- tRNA-Phe
  6074. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Phe
  6075. Salmonella enterica subsp. enterica serovar 6,8,20:-:1,5 tRNA-Phe
  6076. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Phe
  6077. Salmonella enterica subsp. enterica serovar 6,8,[20]:e,h- tRNA-Phe
  6078. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Phe
  6079. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Phe
  6080. Salmonella enterica subsp. enterica serovar 6,8:z4,z23:- tRNA-Phe
  6081. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Phe
  6082. Salmonella enterica subsp. enterica serovar 7:r:1,5 tRNA-Phe
  6083. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Phe
  6084. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Phe
  6085. Salmonella enterica subsp. enterica serovar 8:z10:z6 tRNA-Phe
  6086. Salmonella enterica subsp. enterica serovar 9,12-:1,5 tRNA-Phe
  6087. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Phe
  6088. Salmonella enterica subsp. enterica serovar 9,12:g,m:- tRNA-Phe
  6089. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Phe
  6090. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Phe
  6091. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Phe
  6092. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Phe
  6093. Salmonella enterica subsp. enterica serovar 9,46:nonmotile tRNA-Phe
  6094. Salmonella enterica subsp. enterica serovar 9:g,m,q:1,5 tRNA-Phe
  6095. Salmonella enterica subsp. enterica serovar 9:l,z28:1,2 tRNA-Phe
  6096. Salmonella enterica subsp. enterica serovar 9:-:- tRNA-Phe
  6097. Salmonella enterica subsp. enterica serovar 9:z29:- tRNA-Phe
  6098. Salmonella enterica subsp. enterica serovar Abadina tRNA-Phe
  6099. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6100. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Phe
  6101. Salmonella enterica subsp. enterica serovar Aba tRNA-Phe
  6102. Salmonella enterica subsp. enterica serovar Abeokuta tRNA-Phe
  6103. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Phe(gaa)
  6104. Salmonella enterica subsp. enterica serovar Abidjan tRNA-Phe
  6105. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6106. Salmonella enterica subsp. enterica serovar Abony tRNA-Phe
  6107. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Phe
  6108. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Phe
  6109. Salmonella enterica subsp. enterica serovar Abortus tRNA-Phe
  6110. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Phe
  6111. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Phe
  6112. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Phe
  6113. Salmonella enterica subsp. enterica serovar Aderike tRNA-Phe
  6114. Salmonella enterica subsp. enterica serovar Adjame tRNA-Phe
  6115. Salmonella enterica subsp. enterica serovar Africana tRNA-Phe
  6116. Salmonella enterica subsp. enterica serovar Afula tRNA-Phe
  6117. Salmonella enterica subsp. enterica serovar Agama tRNA-Phe
  6118. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Phe
  6119. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Phe
  6120. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Phe
  6121. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Phe
  6122. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6123. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Phe
  6124. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Phe
  6125. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Phe
  6126. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Phe
  6127. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Phe
  6128. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Phe
  6129. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Phe
  6130. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Phe
  6131. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Phe
  6132. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Phe
  6133. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Phe
  6134. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Phe
  6135. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Phe
  6136. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Phe
  6137. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Phe
  6138. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Phe
  6139. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Phe
  6140. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Phe
  6141. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Phe
  6142. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Phe
  6143. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Phe
  6144. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Phe
  6145. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Phe
  6146. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Phe
  6147. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Phe
  6148. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Phe
  6149. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6150. Salmonella enterica subsp. enterica serovar Agona str. 467481 tRNA-Phe
  6151. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Phe
  6152. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Phe
  6153. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Phe
  6154. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Phe
  6155. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Phe
  6156. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Phe
  6157. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Phe
  6158. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Phe
  6159. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Phe
  6160. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Phe
  6161. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Phe
  6162. Salmonella enterica subsp. enterica serovar Agona str. SAR B1 tRNA-Phe
  6163. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Phe
  6164. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Phe
  6165. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Phe
  6166. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6167. Salmonella enterica subsp. enterica serovar Agona serovar Agona tRNA-Phe
  6168. Salmonella enterica subsp. enterica serovar Ago tRNA-Phe
  6169. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Phe
  6170. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Phe
  6171. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Phe
  6172. Salmonella enterica subsp. enterica serovar Akanji tRNA-Phe
  6173. Salmonella enterica subsp. enterica serovar Alabama tRNA-Phe
  6174. Salmonella enterica subsp. enterica serovar Alachua tRNA-Phe
  6175. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Phe
  6176. Salmonella enterica subsp. enterica serovar Albany tRNA-Phe
  6177. Salmonella enterica subsp. enterica serovar Albert tRNA-Phe
  6178. Salmonella enterica subsp. enterica serovar Albuquerque tRNA-Phe
  6179. Salmonella enterica subsp. enterica serovar Allandale tRNA-Phe
  6180. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Phe
  6181. Salmonella enterica subsp. enterica serovar Altona serovar Altona tRNA-Phe
  6182. Salmonella enterica subsp. enterica serovar Amager tRNA-Phe
  6183. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Phe
  6184. Salmonella enterica subsp. enterica serovar Amherstiana tRNA-Phe
  6185. Salmonella enterica subsp. enterica serovar Amina tRNA-Phe
  6186. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Phe
  6187. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Phe
  6188. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Phe
  6189. Salmonella enterica subsp. enterica serovar Anatum str. 0262 tRNA-Phe
  6190. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6191. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6192. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Phe
  6193. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003934 tRNA-Phe
  6194. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003935 tRNA-Phe
  6195. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003936 tRNA-Phe
  6196. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003937 tRNA-Phe
  6197. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003938 tRNA-Phe
  6198. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003942 tRNA-Phe
  6199. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003943 tRNA-Phe
  6200. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003944 tRNA-Phe
  6201. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003945 tRNA-Phe
  6202. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003948 tRNA-Phe
  6203. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003950 tRNA-Phe
  6204. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003960 tRNA-Phe
  6205. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Phe
  6206. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Phe
  6207. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Phe
  6208. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Phe
  6209. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003965 tRNA-Phe
  6210. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Phe
  6211. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003969 tRNA-Phe
  6212. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Phe
  6213. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Phe
  6214. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Phe
  6215. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Phe
  6216. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Phe
  6217. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Phe
  6218. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004000 tRNA-Phe
  6219. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004001 tRNA-Phe
  6220. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004002 tRNA-Phe
  6221. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004004 tRNA-Phe
  6222. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004005 tRNA-Phe
  6223. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004010 tRNA-Phe
  6224. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004011 tRNA-Phe
  6225. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004012 tRNA-Phe
  6226. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004013 tRNA-Phe
  6227. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004014 tRNA-Phe
  6228. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004015 tRNA-Phe
  6229. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004017 tRNA-Phe
  6230. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Phe
  6231. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6232. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Phe
  6233. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Phe
  6234. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Phe
  6235. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Phe
  6236. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Phe
  6237. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Phe
  6238. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Phe
  6239. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Phe
  6240. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Phe
  6241. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Phe
  6242. Salmonella enterica subsp. enterica serovar Anatum subsp. enterica serovar Anatum tRNA-Phe
  6243. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Phe
  6244. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Phe
  6245. Salmonella enterica subsp. enterica serovar Anecho tRNA-Phe
  6246. Salmonella enterica subsp. enterica serovar Anfo tRNA-Phe
  6247. Salmonella enterica subsp. enterica serovar Angers tRNA-Phe
  6248. Salmonella enterica subsp. enterica serovar Angoda tRNA-Phe
  6249. Salmonella enterica subsp. enterica serovar Ank tRNA-Phe
  6250. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Phe
  6251. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Phe
  6252. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Phe
  6253. Salmonella enterica subsp. enterica serovar Apapa tRNA-Phe
  6254. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Phe
  6255. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Phe
  6256. Salmonella enterica subsp. enterica serovar Aqua tRNA-Phe
  6257. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Phe
  6258. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Phe
  6259. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Phe
  6260. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Phe
  6261. Salmonella enterica subsp. enterica serovar Austin tRNA-Phe
  6262. Salmonella enterica subsp. enterica serovar Babelsberg tRNA-Phe
  6263. Salmonella enterica subsp. enterica serovar Badagry tRNA-Phe
  6264. Salmonella enterica subsp. enterica serovar Baguida tRNA-Phe
  6265. Salmonella enterica subsp. enterica serovar Bahati tRNA-Phe
  6266. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Phe
  6267. Salmonella enterica subsp. enterica serovar Baildon str. R6-199 tRNA-Phe
  6268. Salmonella enterica subsp. enterica serovar Baildon tRNA-Phe
  6269. Salmonella enterica subsp. enterica serovar Bakau tRNA-Phe
  6270. Salmonella enterica subsp. enterica serovar Ball tRNA-Phe
  6271. Salmonella enterica subsp. enterica serovar Banana tRNA-Phe
  6272. Salmonella enterica subsp. enterica serovar Banco tRNA-Phe
  6273. Salmonella enterica subsp. enterica serovar Bangkok tRNA-Phe
  6274. Salmonella enterica subsp. enterica serovar Bangui tRNA-Phe
  6275. Salmonella enterica subsp. enterica serovar Bardo tRNA-Phe
  6276. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Phe
  6277. Salmonella enterica subsp. enterica serovar Bareilly str. ATCC 9115 tRNA-Phe
  6278. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Phe
  6279. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Phe
  6280. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Phe
  6281. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Phe
  6282. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Phe
  6283. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000183 tRNA-Phe
  6284. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Phe
  6285. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Phe
  6286. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Phe
  6287. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Phe
  6288. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Phe
  6289. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6290. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Phe
  6291. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Phe
  6292. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Phe
  6293. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Phe
  6294. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Phe
  6295. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Phe
  6296. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Phe
  6297. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000197 tRNA-Phe
  6298. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Phe
  6299. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Phe
  6300. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000200 tRNA-Phe
  6301. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Phe
  6302. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Phe
  6303. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Phe
  6304. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Phe
  6305. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Phe
  6306. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Phe
  6307. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Phe
  6308. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Phe
  6309. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Phe
  6310. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Phe
  6311. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Phe
  6312. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Phe
  6313. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Phe
  6314. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Phe
  6315. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Phe
  6316. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Phe
  6317. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Phe
  6318. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Phe
  6319. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Phe
  6320. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Phe
  6321. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Phe
  6322. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Phe
  6323. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Phe
  6324. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Phe
  6325. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Phe
  6326. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Phe
  6327. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Phe
  6328. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Phe
  6329. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Phe
  6330. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Phe
  6331. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Phe
  6332. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Phe
  6333. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Phe
  6334. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Phe
  6335. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Phe
  6336. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Phe
  6337. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Phe
  6338. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Phe
  6339. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Phe
  6340. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Phe
  6341. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Phe
  6342. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Phe
  6343. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Phe
  6344. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Phe
  6345. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Phe
  6346. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Phe
  6347. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Phe
  6348. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Phe
  6349. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Phe
  6350. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Phe
  6351. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Phe
  6352. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Phe
  6353. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Phe
  6354. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Phe
  6355. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Phe
  6356. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Phe
  6357. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Phe
  6358. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Phe
  6359. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Phe
  6360. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Phe
  6361. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Phe
  6362. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Phe
  6363. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Phe
  6364. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Phe
  6365. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Phe
  6366. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Phe
  6367. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Phe
  6368. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Phe
  6369. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Phe
  6370. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Phe
  6371. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Phe
  6372. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Phe
  6373. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Phe
  6374. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Phe
  6375. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Phe
  6376. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Phe
  6377. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Phe
  6378. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Phe
  6379. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Phe
  6380. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Phe
  6381. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Phe
  6382. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Phe
  6383. Salmonella enterica subsp. enterica serovar Bargny tRNA-Phe
  6384. Salmonella enterica subsp. enterica serovar Barranquilla subsp. enterica serovar Barranquilla tRNA-Phe
  6385. Salmonella enterica subsp. enterica serovar Bassadji tRNA-Phe
  6386. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Phe
  6387. Salmonella enterica subsp. enterica serovar Belem tRNA-Phe
  6388. Salmonella enterica subsp. enterica serovar Belfast tRNA-Phe
  6389. Salmonella enterica subsp. enterica serovar Benin tRNA-Phe
  6390. Salmonella enterica subsp. enterica serovar Benue tRNA-Phe
  6391. Salmonella enterica subsp. enterica serovar Bere tRNA-Phe
  6392. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Phe
  6393. Salmonella enterica subsp. enterica serovar Bergen tRNA-Phe
  6394. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Phe
  6395. Salmonella enterica subsp. enterica serovar Berlin tRNA-Phe
  6396. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Phe
  6397. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Phe
  6398. Salmonella enterica subsp. enterica serovar Berta tRNA-Phe
  6399. Salmonella enterica subsp. enterica serovar Bietri tRNA-Phe
  6400. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Phe
  6401. Salmonella enterica subsp. enterica serovar Binza tRNA-Phe
  6402. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Phe
  6403. Salmonella enterica subsp. enterica serovar Birmingham tRNA-Phe
  6404. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Phe
  6405. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Phe
  6406. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Phe
  6407. Salmonella enterica subsp. enterica serovar Blijdorp tRNA-Phe
  6408. Salmonella enterica subsp. enterica serovar Blitta tRNA-Phe
  6409. Salmonella enterica subsp. enterica serovar Blockley tRNA-Phe
  6410. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Phe
  6411. Salmonella enterica subsp. enterica serovar B:l,v:- tRNA-Phe
  6412. Salmonella enterica subsp. enterica serovar Bochum tRNA-Phe
  6413. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Phe
  6414. Salmonella enterica subsp. enterica serovar Bonn tRNA-Phe
  6415. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Phe
  6416. Salmonella enterica subsp. enterica serovar Bournemouth tRNA-Phe
  6417. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6418. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Phe
  6419. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Phe(gaa)
  6420. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Phe
  6421. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Phe
  6422. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Phe
  6423. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Phe
  6424. Salmonella enterica subsp. enterica serovar Braenderup serovar Braenderup tRNA-Phe(gaa)
  6425. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Phe
  6426. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Phe
  6427. Salmonella enterica subsp. enterica serovar Brazil tRNA-Phe
  6428. Salmonella enterica subsp. enterica serovar Brazos tRNA-Phe
  6429. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Phe
  6430. Salmonella enterica subsp. enterica serovar Breda tRNA-Phe
  6431. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6432. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Phe(gaa)
  6433. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Phe
  6434. Salmonella enterica subsp. enterica serovar Brevik tRNA-Phe
  6435. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Phe
  6436. Salmonella enterica subsp. enterica serovar Brikama tRNA-Phe
  6437. Salmonella enterica subsp. enterica serovar Brisbane tRNA-Phe
  6438. Salmonella enterica subsp. enterica serovar Bristol tRNA-Phe
  6439. Salmonella enterica subsp. enterica serovar Bron tRNA-Phe
  6440. Salmonella enterica subsp. enterica serovar Broughton tRNA-Phe
  6441. Salmonella enterica subsp. enterica serovar Bruck tRNA-Phe
  6442. Salmonella enterica subsp. enterica serovar Brunei tRNA-Phe
  6443. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Phe
  6444. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Phe
  6445. Salmonella enterica subsp. enterica serovar Bullbay tRNA-Phe
  6446. Salmonella enterica subsp. enterica serovar Butantan tRNA-Phe
  6447. Salmonella enterica subsp. enterica serovar Buzu tRNA-Phe
  6448. Salmonella enterica subsp. enterica serovar Cairina tRNA-Phe
  6449. Salmonella enterica subsp. enterica serovar Calabar tRNA-Phe
  6450. Salmonella enterica subsp. enterica serovar California tRNA-Phe
  6451. Salmonella enterica subsp. enterica serovar Canada tRNA-Phe
  6452. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Phe
  6453. Salmonella enterica subsp. enterica serovar Caracas tRNA-Phe
  6454. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Phe
  6455. Salmonella enterica subsp. enterica serovar Carmel tRNA-Phe
  6456. Salmonella enterica subsp. enterica serovar Carno tRNA-Phe
  6457. Salmonella enterica subsp. enterica serovar Carrau tRNA-Phe
  6458. Salmonella enterica subsp. enterica serovar Carswell tRNA-Phe
  6459. Salmonella enterica subsp. enterica serovar Casablanca tRNA-Phe
  6460. Salmonella enterica subsp. enterica serovar Catumagos tRNA-Phe
  6461. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Phe
  6462. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Phe
  6463. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Phe
  6464. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Phe
  6465. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Phe
  6466. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Phe
  6467. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Phe
  6468. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Phe
  6469. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Phe
  6470. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Phe
  6471. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Phe
  6472. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Phe
  6473. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Phe
  6474. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Phe
  6475. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Phe
  6476. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Phe
  6477. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Phe
  6478. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Phe
  6479. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Phe
  6480. Salmonella enterica subsp. enterica serovar Cerro serovar Cerro tRNA-Phe
  6481. Salmonella enterica subsp. enterica serovar Ceyco tRNA-Phe
  6482. Salmonella enterica subsp. enterica serovar Chailey tRNA-Phe
  6483. Salmonella enterica subsp. enterica serovar Champaign tRNA-Phe
  6484. Salmonella enterica subsp. enterica serovar Chandans tRNA-Phe
  6485. Salmonella enterica subsp. enterica serovar Charity tRNA-Phe
  6486. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Phe
  6487. Salmonella enterica subsp. enterica serovar Chester tRNA-Phe
  6488. Salmonella enterica subsp. enterica serovar Chicago tRNA-Phe
  6489. Salmonella enterica subsp. enterica serovar Chichester tRNA-Phe
  6490. Salmonella enterica subsp. enterica serovar Chincol tRNA-Phe
  6491. Salmonella enterica subsp. enterica serovar Chingola tRNA-Phe
  6492. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Phe
  6493. Salmonella enterica subsp. enterica serovar Choleraesuis str. 0006 tRNA-Phe
  6494. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Phe
  6495. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Phe
  6496. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Phe
  6497. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6498. Salmonella enterica subsp. enterica serovar Choleraesuis str. SCSA50 tRNA-Phe
  6499. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6500. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Phe
  6501. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Phe
  6502. Salmonella enterica subsp. enterica serovar Claibornei tRNA-Phe
  6503. Salmonella enterica subsp. enterica serovar Coeln tRNA-Phe
  6504. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Phe
  6505. Salmonella enterica subsp. enterica serovar Colindale tRNA-Phe
  6506. Salmonella enterica subsp. enterica serovar Colorado tRNA-Phe
  6507. Salmonella enterica subsp. enterica serovar Concord tRNA-Phe
  6508. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Phe
  6509. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Phe
  6510. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Phe
  6511. Salmonella enterica subsp. enterica serovar Cotham tRNA-Phe
  6512. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Phe
  6513. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Phe
  6514. Salmonella enterica subsp. enterica serovar Cubana str. 76814 tRNA-Phe
  6515. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN001083 tRNA-Phe
  6516. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  6517. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Phe
  6518. Salmonella enterica subsp. enterica serovar Cubana tRNA-Phe
  6519. Salmonella enterica subsp. enterica serovar Cuckmere tRNA-Phe
  6520. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Phe
  6521. Salmonella enterica subsp. enterica serovar Curacao tRNA-Phe
  6522. Salmonella enterica subsp. enterica serovar -:d:1,2 tRNA-Phe
  6523. Salmonella enterica subsp. enterica serovar -:d:1,5 tRNA-Phe
  6524. Salmonella enterica subsp. enterica serovar Dabou tRNA-Phe
  6525. Salmonella enterica subsp. enterica serovar Dahomey tRNA-Phe
  6526. Salmonella enterica subsp. enterica serovar Dahra tRNA-Phe
  6527. Salmonella enterica subsp. enterica serovar Daytona tRNA-Phe(gaa)
  6528. Salmonella enterica subsp. enterica serovar Decatur str. CFSAN000563 tRNA-Phe
  6529. Salmonella enterica subsp. enterica serovar Decatur tRNA-Phe
  6530. Salmonella enterica subsp. enterica serovar Denver tRNA-Phe
  6531. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Phe
  6532. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Phe
  6533. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Phe
  6534. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Phe
  6535. Salmonella enterica subsp. enterica serovar Derby tRNA-Phe(gaa)
  6536. Salmonella enterica subsp. enterica serovar Dessau tRNA-Phe
  6537. Salmonella enterica subsp. enterica serovar Diguel tRNA-Phe
  6538. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Phe
  6539. Salmonella enterica subsp. enterica serovar Djakarta tRNA-Phe
  6540. Salmonella enterica subsp. enterica serovar Djugu tRNA-Phe
  6541. Salmonella enterica subsp. enterica serovar Dortmund tRNA-Phe
  6542. Salmonella enterica subsp. enterica serovar Drac tRNA-Phe
  6543. Salmonella enterica subsp. enterica serovar Dublin str. 0773 tRNA-Phe
  6544. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Phe
  6545. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000516 tRNA-Phe
  6546. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Phe
  6547. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Phe
  6548. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6549. Salmonella enterica subsp. enterica serovar Dublin str. DG22 tRNA-Phe
  6550. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Phe
  6551. Salmonella enterica subsp. enterica serovar Dublin str. SD3246 tRNA-Phe
  6552. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Phe
  6553. Salmonella enterica subsp. enterica serovar Dublin serovar Dublin tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6554. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Phe
  6555. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Phe
  6556. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Phe
  6557. Salmonella enterica subsp. enterica serovar Durban tRNA-Phe
  6558. Salmonella enterica subsp. enterica serovar Durham tRNA-Phe
  6559. Salmonella enterica subsp. enterica serovar Duval tRNA-Phe
  6560. Salmonella enterica subsp. enterica serovar Ealing tRNA-Phe
  6561. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Phe
  6562. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Phe
  6563. Salmonella enterica subsp. enterica serovar Eboko tRNA-Phe
  6564. Salmonella enterica subsp. enterica serovar Edinburgh tRNA-Phe
  6565. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Phe
  6566. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Phe
  6567. Salmonella enterica subsp. enterica serovar Eko tRNA-Phe
  6568. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Phe
  6569. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Phe
  6570. Salmonella enterica subsp. enterica serovar Elokate tRNA-Phe
  6571. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Phe
  6572. Salmonella enterica subsp. enterica serovar Emek tRNA-Phe
  6573. Salmonella enterica subsp. enterica serovar Emmastad tRNA-Phe
  6574. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Phe
  6575. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Phe
  6576. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Phe
  6577. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Phe
  6578. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Phe
  6579. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Phe
  6580. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K0958 tRNA-Phe
  6581. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1651 tRNA-Phe
  6582. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1726 tRNA-Phe
  6583. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0262 tRNA-Phe
  6584. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0267 tRNA-Phe
  6585. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0271 tRNA-Phe
  6586. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0284 tRNA-Phe
  6587. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0286 tRNA-Phe
  6588. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Phe
  6589. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Phe
  6590. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Phe
  6591. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Phe
  6592. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Phe
  6593. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Phe
  6594. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Phe
  6595. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Phe
  6596. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Phe
  6597. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Phe
  6598. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Phe
  6599. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Phe
  6600. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Phe
  6601. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Phe
  6602. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Phe
  6603. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Phe
  6604. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Phe
  6605. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Phe
  6606. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Phe
  6607. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Phe
  6608. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Phe
  6609. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Phe
  6610. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Phe
  6611. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Phe
  6612. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Phe
  6613. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Phe
  6614. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Phe
  6615. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Phe
  6616. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Phe
  6617. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Phe
  6618. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Phe
  6619. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Phe
  6620. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Phe
  6621. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Phe
  6622. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Phe
  6623. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Phe
  6624. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Phe
  6625. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Phe
  6626. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Phe
  6627. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Phe
  6628. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Phe
  6629. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Phe
  6630. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Phe
  6631. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Phe
  6632. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Phe
  6633. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Phe
  6634. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Phe
  6635. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Phe
  6636. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Phe
  6637. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Phe
  6638. Salmonella enterica subsp. enterica serovar Enteritidis str. 674470_11-10 tRNA-Phe
  6639. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Phe
  6640. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Phe
  6641. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6642. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Phe
  6643. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Phe
  6644. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Phe
  6645. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Phe
  6646. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Phe
  6647. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Phe
  6648. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Phe
  6649. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6650. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Phe
  6651. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Phe
  6652. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Phe
  6653. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Phe
  6654. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Phe
  6655. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Phe
  6656. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Phe
  6657. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Phe
  6658. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Phe
  6659. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Phe
  6660. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Phe
  6661. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Phe
  6662. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Phe
  6663. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Phe
  6664. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Phe
  6665. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Phe
  6666. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Phe
  6667. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Phe
  6668. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Phe
  6669. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Phe
  6670. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Phe
  6671. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Phe
  6672. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Phe
  6673. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Phe
  6674. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Phe
  6675. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Phe
  6676. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Phe
  6677. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Phe
  6678. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN004342 tRNA-Phe
  6679. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Phe
  6680. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Phe
  6681. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Phe
  6682. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Phe
  6683. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Phe
  6684. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Phe
  6685. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Phe
  6686. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6687. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6688. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6689. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6690. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6691. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6692. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6693. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6694. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6695. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6696. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6697. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6698. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6699. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6700. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6701. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6702. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6703. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6704. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6705. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6706. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6707. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6708. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6709. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6710. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6711. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6712. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6713. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6714. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6715. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6716. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6717. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6718. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6719. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6720. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6721. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6722. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6723. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6724. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6725. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6726. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6727. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6728. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6729. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6730. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  6731. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6732. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6733. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6734. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6735. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6736. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6737. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6738. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6739. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6740. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6741. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6742. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6743. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6744. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6745. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6746. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6747. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6748. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6749. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6750. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6751. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  6752. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6753. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6754. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6755. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6756. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6757. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6758. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6759. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6760. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6761. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6762. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6763. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6764. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6765. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6766. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6767. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6768. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6769. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6770. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6771. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6772. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6773. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6774. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6775. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Phe
  6776. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6777. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6778. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6779. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  6780. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6781. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6782. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6783. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6784. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6785. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6786. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6787. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6788. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6789. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6790. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6791. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6792. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6793. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6794. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6795. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6796. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6797. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6798. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6799. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6800. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6801. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6802. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6803. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6804. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6805. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6806. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6807. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6808. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6809. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6810. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6811. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6812. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6813. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6814. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Phe
  6815. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Phe
  6816. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6817. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6818. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6819. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6820. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6821. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6822. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6823. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6824. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6825. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6826. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6827. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6828. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6829. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6830. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6831. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6832. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6833. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6834. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6835. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6836. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6837. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6838. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6839. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6840. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6841. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6842. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6843. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6844. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6845. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6846. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6847. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6848. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6849. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6850. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6851. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6852. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6853. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6854. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6855. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6856. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6857. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6858. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6859. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6860. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6861. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6862. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6863. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6864. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6865. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  6866. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6867. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6868. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6869. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6870. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Phe
  6871. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Phe
  6872. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Phe
  6873. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Phe
  6874. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Phe
  6875. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Phe
  6876. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Phe
  6877. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Phe
  6878. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Phe
  6879. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Phe
  6880. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Phe
  6881. Salmonella enterica subsp. enterica serovar Enteritidis subsp. enterica serovar Enteritidis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6882. Salmonella enterica subsp. enterica serovar Enugu tRNA-Phe
  6883. Salmonella enterica subsp. enterica serovar Eppendorf tRNA-Phe
  6884. Salmonella enterica subsp. enterica serovar Eschberg tRNA-Phe
  6885. Salmonella enterica subsp. enterica serovar Essen tRNA-Phe
  6886. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Phe
  6887. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Phe
  6888. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Phe
  6889. Salmonella enterica subsp. enterica serovar Fann tRNA-Phe
  6890. Salmonella enterica subsp. enterica serovar Fanti tRNA-Phe
  6891. Salmonella enterica subsp. enterica serovar Farmingdale tRNA-Phe
  6892. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Phe
  6893. Salmonella enterica subsp. enterica serovar Fillmore tRNA-Phe
  6894. Salmonella enterica subsp. enterica serovar Fischerhuette tRNA-Phe
  6895. Salmonella enterica subsp. enterica serovar Fischerstrasse tRNA-Phe
  6896. Salmonella enterica subsp. enterica serovar Florian tRNA-Phe
  6897. Salmonella enterica subsp. enterica serovar Florida tRNA-Phe
  6898. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Phe
  6899. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Phe
  6900. Salmonella enterica subsp. enterica serovar Fomeco tRNA-Phe
  6901. Salmonella enterica subsp. enterica serovar Freetown tRNA-Phe
  6902. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Phe
  6903. Salmonella enterica subsp. enterica serovar Fresno tRNA-Phe
  6904. Salmonella enterica subsp. enterica serovar Friedenau tRNA-Phe
  6905. Salmonella enterica subsp. enterica serovar Friedrichsfelde tRNA-Phe
  6906. Salmonella enterica subsp. enterica serovar Frintrop tRNA-Phe
  6907. Salmonella enterica subsp. enterica serovar Fufu tRNA-Phe
  6908. Salmonella enterica subsp. enterica serovar Fulica tRNA-Phe
  6909. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Phe
  6910. Salmonella enterica subsp. enterica serovar Galiema tRNA-Phe
  6911. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6912. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Phe
  6913. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6914. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum tRNA-Phe
  6915. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6916. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Phe
  6917. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Phe
  6918. Salmonella enterica subsp. enterica serovar Gallinarum str. SG9 tRNA-Phe
  6919. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Phe
  6920. Salmonella enterica subsp. enterica serovar Gambia tRNA-Phe
  6921. Salmonella enterica subsp. enterica serovar Gaminara str. A4-567 tRNA-Phe
  6922. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Phe
  6923. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Phe
  6924. Salmonella enterica subsp. enterica serovar Gaminara subsp. enterica serovar Gaminara tRNA-Phe
  6925. Salmonella enterica subsp. enterica serovar Garoli tRNA-Phe
  6926. Salmonella enterica subsp. enterica serovar Gateshead tRNA-Phe
  6927. Salmonella enterica subsp. enterica serovar Gatineau tRNA-Phe
  6928. Salmonella enterica subsp. enterica serovar Gatow tRNA-Phe
  6929. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Phe
  6930. Salmonella enterica subsp. enterica serovar Gbadago tRNA-Phe
  6931. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Phe
  6932. Salmonella enterica subsp. enterica serovar Georgia tRNA-Phe
  6933. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Phe
  6934. Salmonella enterica subsp. enterica serovar Gera tRNA-Phe
  6935. Salmonella enterica subsp. enterica serovar Giessen tRNA-Phe
  6936. Salmonella enterica subsp. enterica serovar Give str. 564 tRNA-Phe
  6937. Salmonella enterica subsp. enterica serovar Give str. S5-487 tRNA-Phe
  6938. Salmonella enterica subsp. enterica serovar Give tRNA-Phe
  6939. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Phe
  6940. Salmonella enterica subsp. enterica serovar Give_var._15+ tRNA-Phe
  6941. Salmonella enterica subsp. enterica serovar Giza tRNA-Phe
  6942. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Phe
  6943. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Phe
  6944. Salmonella enterica subsp. enterica serovar -:g,m,s:- tRNA-Phe
  6945. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Phe
  6946. Salmonella enterica subsp. enterica serovar Goelzau tRNA-Phe
  6947. Salmonella enterica subsp. enterica serovar Gokul tRNA-Phe
  6948. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Phe
  6949. Salmonella enterica subsp. enterica serovar Gombe tRNA-Phe
  6950. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Phe
  6951. Salmonella enterica subsp. enterica serovar Gozo tRNA-Phe
  6952. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Phe
  6953. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Phe
  6954. Salmonella enterica subsp. enterica serovar Guildford tRNA-Phe
  6955. Salmonella enterica subsp. enterica serovar Guinea tRNA-Phe
  6956. Salmonella enterica subsp. enterica serovar Haardt tRNA-Phe
  6957. Salmonella enterica subsp. enterica serovar Hadar str. ATCC 51956 tRNA-Phe
  6958. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Phe
  6959. Salmonella enterica subsp. enterica serovar Hadar tRNA-Phe
  6960. Salmonella enterica subsp. enterica serovar Haduna tRNA-Phe
  6961. Salmonella enterica subsp. enterica serovar Haga tRNA-Phe
  6962. Salmonella enterica subsp. enterica serovar Haifa tRNA-Phe
  6963. Salmonella enterica subsp. enterica serovar Halle tRNA-Phe
  6964. Salmonella enterica subsp. enterica serovar Hann tRNA-Phe
  6965. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Phe
  6966. Salmonella enterica subsp. enterica serovar Hartford tRNA-Phe(gaa)
  6967. Salmonella enterica subsp. enterica serovar Hato tRNA-Phe
  6968. Salmonella enterica subsp. enterica serovar Havana str. CFSAN001082 tRNA-Phe
  6969. Salmonella enterica subsp. enterica serovar Havana tRNA-Phe(gaa)
  6970. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Phe
  6971. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Phe
  6972. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Phe
  6973. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Phe
  6974. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Phe
  6975. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Phe
  6976. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Phe
  6977. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Phe
  6978. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Phe
  6979. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Phe
  6980. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Phe
  6981. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Phe
  6982. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  6983. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Phe
  6984. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Phe
  6985. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Phe
  6986. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Phe
  6987. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Phe
  6988. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Phe
  6989. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Phe
  6990. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Phe
  6991. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Phe
  6992. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Phe
  6993. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Phe
  6994. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Phe
  6995. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Phe
  6996. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-15 tRNA-Phe
  6997. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-21 tRNA-Phe
  6998. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Phe
  6999. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Phe
  7000. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Phe
  7001. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Phe
  7002. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Phe
  7003. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Phe
  7004. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Phe
  7005. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Phe
  7006. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Phe
  7007. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Phe
  7008. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Phe
  7009. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Phe
  7010. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Phe
  7011. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Phe
  7012. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Phe
  7013. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Phe
  7014. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Phe
  7015. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Phe
  7016. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Phe
  7017. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Phe
  7018. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7019. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000576 tRNA-Phe
  7020. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Phe
  7021. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Phe
  7022. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Phe
  7023. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Phe
  7024. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Phe
  7025. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Phe
  7026. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Phe
  7027. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Phe
  7028. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Phe
  7029. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Phe
  7030. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Phe
  7031. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Phe
  7032. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7033. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Phe
  7034. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Phe
  7035. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Phe
  7036. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Phe
  7037. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7038. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002070 tRNA-Phe
  7039. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Phe
  7040. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Phe
  7041. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Phe
  7042. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Phe
  7043. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Phe
  7044. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Phe
  7045. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Phe
  7046. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Phe
  7047. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Phe
  7048. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Phe
  7049. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Phe
  7050. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Phe
  7051. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003460 tRNA-Phe
  7052. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003461 tRNA-Phe
  7053. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003462 tRNA-Phe
  7054. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Phe
  7055. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003464 tRNA-Phe
  7056. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003465 tRNA-Phe
  7057. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003466 tRNA-Phe
  7058. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Phe
  7059. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Phe
  7060. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Phe
  7061. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003470 tRNA-Phe
  7062. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003471 tRNA-Phe
  7063. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Phe
  7064. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003473 tRNA-Phe
  7065. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003474 tRNA-Phe
  7066. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Phe
  7067. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003476 tRNA-Phe
  7068. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003477 tRNA-Phe
  7069. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003478 tRNA-Phe
  7070. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003479 tRNA-Phe
  7071. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003480 tRNA-Phe
  7072. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003481 tRNA-Phe
  7073. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Phe
  7074. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003483 tRNA-Phe
  7075. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Phe
  7076. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Phe
  7077. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003486 tRNA-Phe
  7078. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003487 tRNA-Phe
  7079. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003488 tRNA-Phe
  7080. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM20752 tRNA-Phe
  7081. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Phe
  7082. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Phe
  7083. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Phe
  7084. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Phe
  7085. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Phe
  7086. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Phe
  7087. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Phe
  7088. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Phe
  7089. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Phe
  7090. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Phe
  7091. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Phe
  7092. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Phe
  7093. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Phe
  7094. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Phe
  7095. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Phe
  7096. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Phe
  7097. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Phe
  7098. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Phe
  7099. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Phe
  7100. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Phe
  7101. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Phe
  7102. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Phe
  7103. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Phe
  7104. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Phe
  7105. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Phe
  7106. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Phe
  7107. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Phe
  7108. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Phe
  7109. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Phe
  7110. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Phe
  7111. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Phe
  7112. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Phe
  7113. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Phe
  7114. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Phe
  7115. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Phe
  7116. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Phe
  7117. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Phe
  7118. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Phe
  7119. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Phe
  7120. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7121. Salmonella enterica subsp. enterica serovar Heidelberg subsp. enterica serovar Heidelberg tRNA-Phe
  7122. Salmonella enterica subsp. enterica serovar Hermannswerder tRNA-Phe
  7123. Salmonella enterica subsp. enterica serovar Herston tRNA-Phe
  7124. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Phe
  7125. Salmonella enterica subsp. enterica serovar Hidalgo tRNA-Phe
  7126. Salmonella enterica subsp. enterica serovar Hiduddify tRNA-Phe
  7127. Salmonella enterica subsp. enterica serovar Hillegersberg tRNA-Phe
  7128. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Phe
  7129. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Phe
  7130. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Phe
  7131. Salmonella enterica subsp. enterica serovar Hissar tRNA-Phe
  7132. Salmonella enterica subsp. enterica serovar Hofit tRNA-Phe
  7133. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Phe
  7134. Salmonella enterica subsp. enterica serovar Horsham tRNA-Phe
  7135. Salmonella enterica subsp. enterica serovar Houston tRNA-Phe
  7136. Salmonella enterica subsp. enterica serovar Huettwilen tRNA-Phe
  7137. Salmonella enterica subsp. enterica serovar Hull tRNA-Phe
  7138. Salmonella enterica subsp. enterica serovar Hvittingfoss str. A4-620 tRNA-Phe
  7139. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Phe
  7140. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Phe
  7141. Salmonella enterica subsp. enterica serovar -:i:1,2 tRNA-Phe
  7142. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Phe
  7143. Salmonella enterica subsp. enterica serovar Idikan tRNA-Phe
  7144. Salmonella enterica subsp. enterica serovar Ilala tRNA-Phe
  7145. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Phe
  7146. Salmonella enterica subsp. enterica serovar Indiana tRNA-Phe
  7147. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Phe
  7148. Salmonella enterica subsp. enterica serovar India tRNA-Phe
  7149. Salmonella enterica subsp. enterica serovar Infantis str. 119944 tRNA-Phe
  7150. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Phe
  7151. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000521 tRNA-Phe
  7152. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Phe
  7153. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Phe
  7154. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Phe
  7155. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Phe
  7156. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Phe
  7157. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Phe
  7158. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Phe
  7159. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Phe
  7160. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Phe
  7161. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Phe
  7162. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Phe
  7163. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Phe
  7164. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Phe
  7165. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Phe
  7166. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Phe
  7167. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Phe
  7168. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Phe
  7169. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Phe
  7170. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Phe
  7171. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Phe
  7172. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Phe
  7173. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Phe
  7174. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Phe
  7175. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Phe
  7176. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Phe
  7177. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Phe
  7178. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Phe
  7179. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Phe
  7180. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Phe
  7181. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Phe
  7182. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Phe
  7183. Salmonella enterica subsp. enterica serovar Infantis str. SARB27 tRNA-Phe
  7184. Salmonella enterica subsp. enterica serovar Infantis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7185. Salmonella enterica subsp. enterica serovar Inganda tRNA-Phe
  7186. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Phe
  7187. Salmonella enterica subsp. enterica serovar Inverness tRNA-Phe
  7188. Salmonella enterica subsp. enterica serovar Ipeko tRNA-Phe
  7189. Salmonella enterica subsp. enterica serovar Irumu tRNA-Phe
  7190. Salmonella enterica subsp. enterica serovar Isangi tRNA-Phe
  7191. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Phe
  7192. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Phe
  7193. Salmonella enterica subsp. enterica serovar Itami tRNA-Phe
  7194. Salmonella enterica subsp. enterica serovar Ituri tRNA-Phe
  7195. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Phe
  7196. Salmonella enterica subsp. enterica serovar Paratyphi B var. L(+) tartrate + tRNA-Phe(gaa)
  7197. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Phe
  7198. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Phe
  7199. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Phe
  7200. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Phe
  7201. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7202. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Phe
  7203. Salmonella enterica subsp. enterica serovar Javiana serovar Javiana tRNA-Phe
  7204. Salmonella enterica subsp. enterica serovar Jedburgh tRNA-Phe
  7205. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Phe
  7206. Salmonella enterica subsp. enterica serovar Joal tRNA-Phe
  7207. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Phe
  7208. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Phe
  7209. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Phe
  7210. Salmonella enterica subsp. enterica serovar Johannesburg subsp. enterica serovar Johannesburg tRNA-Phe
  7211. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Phe
  7212. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Phe
  7213. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Phe
  7214. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Phe
  7215. Salmonella enterica subsp. enterica serovar Kallo tRNA-Phe
  7216. Salmonella enterica subsp. enterica serovar Kalumburu tRNA-Phe
  7217. Salmonella enterica subsp. enterica serovar Kambole tRNA-Phe
  7218. Salmonella enterica subsp. enterica serovar Kampala tRNA-Phe
  7219. Salmonella enterica subsp. enterica serovar Kande tRNA-Phe
  7220. Salmonella enterica subsp. enterica serovar Kandla tRNA-Phe
  7221. Salmonella enterica subsp. enterica serovar Kaneshie tRNA-Phe
  7222. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Phe
  7223. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Phe
  7224. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Phe
  7225. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Phe
  7226. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Phe
  7227. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Phe
  7228. Salmonella enterica subsp. enterica serovar Kentucky str. 0253 tRNA-Phe
  7229. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Phe
  7230. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Phe
  7231. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Phe
  7232. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Phe
  7233. Salmonella enterica subsp. enterica serovar Kentucky str. 29439 tRNA-Phe
  7234. Salmonella enterica subsp. enterica serovar Kentucky str. 5349 tRNA-Phe
  7235. Salmonella enterica subsp. enterica serovar Kentucky str. ATCC 9263 tRNA-Phe
  7236. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Phe
  7237. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Phe
  7238. Salmonella enterica subsp. enterica serovar Kentucky subsp. enterica serovar Kentucky tRNA-Phe
  7239. Salmonella enterica subsp. enterica serovar Kenya tRNA-Phe
  7240. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Phe
  7241. Salmonella enterica subsp. enterica serovar Kibi tRNA-Phe
  7242. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Phe
  7243. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Phe
  7244. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Phe
  7245. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Phe
  7246. Salmonella enterica subsp. enterica serovar Kingston tRNA-Phe
  7247. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Phe
  7248. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Phe
  7249. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Phe
  7250. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Phe
  7251. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Phe
  7252. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Phe
  7253. Salmonella enterica subsp. enterica serovar Kisii tRNA-Phe
  7254. Salmonella enterica subsp. enterica serovar Kivu tRNA-Phe
  7255. Salmonella enterica subsp. enterica serovar Kodjovi tRNA-Phe
  7256. Salmonella enterica subsp. enterica serovar Koenigstuhl tRNA-Phe
  7257. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Phe
  7258. Salmonella enterica subsp. enterica serovar Koketime tRNA-Phe
  7259. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Phe
  7260. Salmonella enterica subsp. enterica serovar Koln tRNA-Phe
  7261. Salmonella enterica subsp. enterica serovar Korbol tRNA-Phe
  7262. Salmonella enterica subsp. enterica serovar Korkeasaari tRNA-Phe
  7263. Salmonella enterica subsp. enterica serovar Korlebu tRNA-Phe
  7264. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Phe
  7265. Salmonella enterica subsp. enterica serovar Kotte tRNA-Phe
  7266. Salmonella enterica subsp. enterica serovar Kouka tRNA-Phe
  7267. Salmonella enterica subsp. enterica serovar Koumra tRNA-Phe
  7268. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Phe
  7269. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Phe
  7270. Salmonella enterica subsp. enterica serovar -:k:- tRNA-Phe
  7271. Salmonella enterica subsp. enterica serovar Kua tRNA-Phe
  7272. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Phe
  7273. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Phe
  7274. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Phe
  7275. Salmonella enterica subsp. enterica serovar Labadi tRNA-Phe
  7276. Salmonella enterica subsp. enterica serovar Lagos tRNA-Phe
  7277. Salmonella enterica subsp. enterica serovar Landwasser tRNA-Phe
  7278. Salmonella enterica subsp. enterica serovar Langensalza tRNA-Phe
  7279. Salmonella enterica subsp. enterica serovar Langford tRNA-Phe
  7280. Salmonella enterica subsp. enterica serovar Lanka tRNA-Phe
  7281. Salmonella enterica subsp. enterica serovar Lansing tRNA-Phe
  7282. Salmonella enterica subsp. enterica serovar Laredo tRNA-Phe
  7283. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Phe
  7284. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Phe
  7285. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Phe
  7286. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Phe
  7287. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Phe
  7288. Salmonella enterica subsp. enterica serovar Legon tRNA-Phe
  7289. Salmonella enterica subsp. enterica serovar Lehrte tRNA-Phe
  7290. Salmonella enterica subsp. enterica serovar Leoben tRNA-Phe
  7291. Salmonella enterica subsp. enterica serovar Lerum tRNA-Phe
  7292. Salmonella enterica subsp. enterica serovar Lexington serovar Lexington tRNA-Phe
  7293. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Phe
  7294. Salmonella enterica subsp. enterica serovar Lika tRNA-Phe
  7295. Salmonella enterica subsp. enterica serovar Lille tRNA-Phe
  7296. Salmonella enterica subsp. enterica serovar Limete tRNA-Phe
  7297. Salmonella enterica subsp. enterica serovar Lindern tRNA-Phe
  7298. Salmonella enterica subsp. enterica serovar Linguere tRNA-Phe
  7299. Salmonella enterica subsp. enterica serovar Lingwala tRNA-Phe
  7300. Salmonella enterica subsp. enterica serovar Linton tRNA-Phe
  7301. Salmonella enterica subsp. enterica serovar Litchfield str. CFSAN001076 tRNA-Phe
  7302. Salmonella enterica subsp. enterica serovar Litchfield serovar Litchfield tRNA-Phe
  7303. Salmonella enterica subsp. enterica serovar Liverpool subsp. enterica serovar Liverpool tRNA-Phe
  7304. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Phe
  7305. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Phe
  7306. Salmonella enterica subsp. enterica serovar Loanda tRNA-Phe
  7307. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Phe
  7308. Salmonella enterica subsp. enterica serovar Lome tRNA-Phe
  7309. Salmonella enterica subsp. enterica serovar London str. CFSAN001081 tRNA-Phe
  7310. Salmonella enterica subsp. enterica serovar London tRNA-Phe
  7311. Salmonella enterica subsp. enterica serovar Losangeles tRNA-Phe
  7312. Salmonella enterica subsp. enterica serovar Louga tRNA-Phe
  7313. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Phe
  7314. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Phe
  7315. Salmonella enterica subsp. enterica serovar Luciana tRNA-Phe
  7316. Salmonella enterica subsp. enterica serovar Luckenwalde tRNA-Phe
  7317. Salmonella enterica subsp. enterica serovar Luedinghausen tRNA-Phe
  7318. Salmonella enterica subsp. enterica serovar Luke tRNA-Phe
  7319. Salmonella enterica subsp. enterica serovar Maastricht tRNA-Phe
  7320. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Phe
  7321. Salmonella enterica subsp. enterica serovar Madelia tRNA-Phe(gaa)
  7322. Salmonella enterica subsp. enterica serovar Magwa tRNA-Phe
  7323. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Phe
  7324. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Phe
  7325. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Phe
  7326. Salmonella enterica subsp. enterica serovar Manchester tRNA-Phe
  7327. Salmonella enterica subsp. enterica serovar Manhattan str. 111113 tRNA-Phe-GAA
  7328. Salmonella enterica subsp. enterica serovar Manhattan str. CFSAN001078 tRNA-Phe
  7329. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Phe
  7330. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Phe
  7331. Salmonella enterica subsp. enterica serovar Mapo tRNA-Phe
  7332. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Phe
  7333. Salmonella enterica subsp. enterica serovar Marshall tRNA-Phe
  7334. Salmonella enterica subsp. enterica serovar Matadi tRNA-Phe
  7335. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Phe
  7336. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Phe
  7337. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Phe
  7338. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Phe
  7339. Salmonella enterica subsp. enterica serovar Meleagridis serovar Meleagridis tRNA-Phe
  7340. Salmonella enterica subsp. enterica serovar Memphis tRNA-Phe
  7341. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Phe
  7342. Salmonella enterica subsp. enterica serovar Menston tRNA-Phe
  7343. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Phe
  7344. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Phe
  7345. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Phe
  7346. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Phe
  7347. Salmonella enterica subsp. enterica serovar Miami tRNA-Phe
  7348. Salmonella enterica subsp. enterica serovar Michigan tRNA-Phe
  7349. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Phe
  7350. Salmonella enterica subsp. enterica serovar Midway tRNA-Phe
  7351. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Phe
  7352. Salmonella enterica subsp. enterica serovar Millesi tRNA-Phe
  7353. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Phe
  7354. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Phe
  7355. Salmonella enterica subsp. enterica serovar Minnesota str. A4-603 tRNA-Phe
  7356. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Phe
  7357. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Phe
  7358. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Phe
  7359. Salmonella enterica subsp. enterica serovar Mississippi str. A4-633 tRNA-Phe
  7360. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Phe
  7361. Salmonella enterica subsp. enterica serovar Miyazaki tRNA-Phe
  7362. Salmonella enterica subsp. enterica serovar Moero tRNA-Phe
  7363. Salmonella enterica subsp. enterica serovar Mokola tRNA-Phe
  7364. Salmonella enterica subsp. enterica serovar Molade tRNA-Phe
  7365. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Phe
  7366. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Phe
  7367. Salmonella enterica subsp. enterica serovar Montevideo str. 0263 tRNA-Phe
  7368. Salmonella enterica subsp. enterica serovar Montevideo str. 0269 tRNA-Phe
  7369. Salmonella enterica subsp. enterica serovar Montevideo str. 19N tRNA-Phe
  7370. Salmonella enterica subsp. enterica serovar Montevideo str. 2009083312 tRNA-Phe
  7371. Salmonella enterica subsp. enterica serovar Montevideo str. 2009085258 tRNA-Phe
  7372. Salmonella enterica subsp. enterica serovar Montevideo str. 29N tRNA-Phe
  7373. Salmonella enterica subsp. enterica serovar Montevideo str. 315731156 tRNA-Phe
  7374. Salmonella enterica subsp. enterica serovar Montevideo str. 315996572 tRNA-Phe
  7375. Salmonella enterica subsp. enterica serovar Montevideo str. 316111868 tRNA-Phe
  7376. Salmonella enterica subsp. enterica serovar Montevideo str. 366867 tRNA-Phe
  7377. Salmonella enterica subsp. enterica serovar Montevideo str. 413180 tRNA-Phe
  7378. Salmonella enterica subsp. enterica serovar Montevideo str. 414877 tRNA-Phe
  7379. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Phe
  7380. Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H tRNA-Phe
  7381. Salmonella enterica subsp. enterica serovar Montevideo str. 446600 tRNA-Phe
  7382. Salmonella enterica subsp. enterica serovar Montevideo str. 468879-1 tRNA-Phe
  7383. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-1 tRNA-Phe
  7384. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-3 tRNA-Phe
  7385. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-4 tRNA-Phe
  7386. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7387. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-1 tRNA-Phe
  7388. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-2 tRNA-Phe
  7389. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Phe
  7390. Salmonella enterica subsp. enterica serovar Montevideo str. 556150-1 tRNA-Phe
  7391. Salmonella enterica subsp. enterica serovar Montevideo str. 556152 tRNA-Phe
  7392. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-1 tRNA-Phe
  7393. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Phe
  7394. Salmonella enterica subsp. enterica serovar Montevideo str. 609460 tRNA-Phe
  7395. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Phe
  7396. Salmonella enterica subsp. enterica serovar Montevideo str. 80959-06 tRNA-Phe
  7397. Salmonella enterica subsp. enterica serovar Montevideo str. 81038-01 tRNA-Phe
  7398. Salmonella enterica subsp. enterica serovar Montevideo str. 8387 tRNA-Phe
  7399. Salmonella enterica subsp. enterica serovar Montevideo str. ATCC BAA710 tRNA-Phe
  7400. Salmonella enterica subsp. enterica serovar Montevideo str. CASC_09SCPH15965 tRNA-Phe
  7401. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Phe
  7402. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Phe
  7403. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Phe
  7404. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Phe
  7405. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Phe
  7406. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Phe
  7407. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Phe
  7408. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7409. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Phe
  7410. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035278 tRNA-Phe
  7411. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035318 tRNA-Phe
  7412. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035320 tRNA-Phe
  7413. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035321 tRNA-Phe
  7414. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035327 tRNA-Phe
  7415. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Phe
  7416. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Phe
  7417. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Phe
  7418. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Phe
  7419. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Phe
  7420. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Phe
  7421. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2009159199 tRNA-Phe
  7422. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008282 tRNA-Phe
  7423. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008283 tRNA-Phe
  7424. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008284 tRNA-Phe
  7425. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008285 tRNA-Phe
  7426. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008286 tRNA-Phe
  7427. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008287 tRNA-Phe
  7428. Salmonella enterica subsp. enterica serovar Montevideo str. LQC 10 tRNA-Phe
  7429. Salmonella enterica subsp. enterica serovar Montevideo str. MB101509-0077 tRNA-Phe
  7430. Salmonella enterica subsp. enterica serovar Montevideo str. MB102109-0047 tRNA-Phe
  7431. Salmonella enterica subsp. enterica serovar Montevideo str. MB110209-0055 tRNA-Phe
  7432. Salmonella enterica subsp. enterica serovar Montevideo str. MB111609-0052 tRNA-Phe
  7433. Salmonella enterica subsp. enterica serovar Montevideo str. MD_MDA09249507 tRNA-Phe
  7434. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Phe
  7435. Salmonella enterica subsp. enterica serovar Montevideo str. NC_MB110209-0054 tRNA-Phe
  7436. Salmonella enterica subsp. enterica serovar Montevideo str. OH_2009072675 tRNA-Phe
  7437. Salmonella enterica subsp. enterica serovar Montevideo str. SARB30 tRNA-Phe
  7438. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Phe
  7439. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Phe
  7440. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Phe
  7441. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7442. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Phe
  7443. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Phe
  7444. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Phe
  7445. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Phe(gaa)
  7446. Salmonella enterica subsp. enterica serovar Morehead tRNA-Phe
  7447. Salmonella enterica subsp. enterica serovar Moroto tRNA-Phe
  7448. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Phe
  7449. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Phe
  7450. Salmonella enterica subsp. enterica serovar Moscow tRNA-Phe
  7451. Salmonella enterica subsp. enterica serovar Moualine tRNA-Phe
  7452. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Phe
  7453. Salmonella enterica subsp. enterica serovar Muenchen str. ATCC 8388 tRNA-Phe
  7454. Salmonella enterica subsp. enterica serovar Muenchen str. baa1594 tRNA-Phe
  7455. Salmonella enterica subsp. enterica serovar Muenchen str. baa1674 tRNA-Phe
  7456. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Phe
  7457. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000587 tRNA-Phe
  7458. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Phe
  7459. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Phe
  7460. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Phe
  7461. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Phe
  7462. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Phe
  7463. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Phe
  7464. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Phe
  7465. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Phe
  7466. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Phe
  7467. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Phe
  7468. Salmonella enterica subsp. enterica serovar Muenster tRNA-Phe
  7469. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Phe
  7470. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Phe
  7471. Salmonella enterica subsp. enterica serovar Napoli tRNA-Phe
  7472. Salmonella enterica subsp. enterica serovar Narashino tRNA-Phe
  7473. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001091 tRNA-Phe
  7474. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001092 tRNA-Phe
  7475. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Phe
  7476. Salmonella enterica subsp. enterica serovar Nchauga tRNA-Phe
  7477. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Phe
  7478. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Phe
  7479. Salmonella enterica subsp. enterica serovar Neudorf tRNA-Phe
  7480. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Phe
  7481. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Phe
  7482. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Phe
  7483. Salmonella enterica subsp. enterica serovar Newington tRNA-Phe
  7484. Salmonella enterica subsp. enterica serovar Newlands tRNA-Phe
  7485. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Phe
  7486. Salmonella enterica subsp. enterica serovar Newport str. 0267 tRNA-Phe
  7487. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Phe
  7488. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Phe
  7489. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Phe
  7490. Salmonella enterica subsp. enterica serovar Newport str. 36796 tRNA-Phe
  7491. Salmonella enterica subsp. enterica serovar Newport str. 36799 tRNA-Phe
  7492. Salmonella enterica subsp. enterica serovar Newport str. 36801 tRNA-Phe
  7493. Salmonella enterica subsp. enterica serovar Newport str. 36802 tRNA-Phe
  7494. Salmonella enterica subsp. enterica serovar Newport str. 36803 tRNA-Phe
  7495. Salmonella enterica subsp. enterica serovar Newport str. 36804 tRNA-Phe
  7496. Salmonella enterica subsp. enterica serovar Newport str. 36805 tRNA-Phe
  7497. Salmonella enterica subsp. enterica serovar Newport str. 36807 tRNA-Phe
  7498. Salmonella enterica subsp. enterica serovar Newport str. 637564_17 tRNA-Phe
  7499. Salmonella enterica subsp. enterica serovar Newport str. A182RVB tRNA-Phe
  7500. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Phe
  7501. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Phe
  7502. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Phe
  7503. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7504. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Phe
  7505. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Phe
  7506. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Phe
  7507. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Phe
  7508. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000599 tRNA-Phe
  7509. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Phe
  7510. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Phe
  7511. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Phe
  7512. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Phe
  7513. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Phe
  7514. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Phe
  7515. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Phe
  7516. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Phe
  7517. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Phe
  7518. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Phe
  7519. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Phe
  7520. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Phe
  7521. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001633 tRNA-Phe
  7522. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001634 tRNA-Phe
  7523. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001635 tRNA-Phe
  7524. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001636 tRNA-Phe
  7525. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001637 tRNA-Phe
  7526. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001638 tRNA-Phe
  7527. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001639 tRNA-Phe
  7528. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001640 tRNA-Phe
  7529. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001641 tRNA-Phe
  7530. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001642 tRNA-Phe
  7531. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001643 tRNA-Phe
  7532. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001644 tRNA-Phe
  7533. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001645 tRNA-Phe
  7534. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001646 tRNA-Phe
  7535. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001647 tRNA-Phe
  7536. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001648 tRNA-Phe
  7537. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001661 tRNA-Phe
  7538. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Phe
  7539. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Phe
  7540. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001891 tRNA-Phe
  7541. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Phe
  7542. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Phe
  7543. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Phe
  7544. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Phe
  7545. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Phe
  7546. Salmonella enterica subsp. enterica serovar Newport str. CVM 19443 tRNA-Phe
  7547. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Phe
  7548. Salmonella enterica subsp. enterica serovar Newport str. CVM 19449 tRNA-Phe
  7549. Salmonella enterica subsp. enterica serovar Newport str. CVM 19470 tRNA-Phe
  7550. Salmonella enterica subsp. enterica serovar Newport str. CVM 19536 tRNA-Phe
  7551. Salmonella enterica subsp. enterica serovar Newport str. CVM 19567 tRNA-Phe
  7552. Salmonella enterica subsp. enterica serovar Newport str. CVM 19593 tRNA-Phe
  7553. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Phe
  7554. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Phe
  7555. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Phe
  7556. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7557. Salmonella enterica subsp. enterica serovar Newport str. CVM 21539 tRNA-Phe
  7558. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7559. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7560. Salmonella enterica subsp. enterica serovar Newport str. CVM 21559 tRNA-Phe
  7561. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7562. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Phe
  7563. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7564. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7565. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Phe
  7566. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Phe
  7567. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Phe
  7568. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Phe
  7569. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Phe
  7570. Salmonella enterica subsp. enterica serovar Newport str. CVM 33953 tRNA-Phe
  7571. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Phe
  7572. Salmonella enterica subsp. enterica serovar Newport str. CVM 35185 tRNA-Phe
  7573. Salmonella enterica subsp. enterica serovar Newport str. CVM 35188 tRNA-Phe
  7574. Salmonella enterica subsp. enterica serovar Newport str. CVM 35199 tRNA-Phe
  7575. Salmonella enterica subsp. enterica serovar Newport str. CVM 35202 tRNA-Phe
  7576. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Phe
  7577. Salmonella enterica subsp. enterica serovar Newport str. CVM 4176 tRNA-Phe
  7578. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Phe
  7579. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Phe
  7580. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Phe
  7581. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Phe
  7582. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7583. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7584. Salmonella enterica subsp. enterica serovar Newport str. DC_10-446 tRNA-Phe
  7585. Salmonella enterica subsp. enterica serovar Newport str. DC_10-449 tRNA-Phe
  7586. Salmonella enterica subsp. enterica serovar Newport str. DC_10-450 tRNA-Phe
  7587. Salmonella enterica subsp. enterica serovar Newport str. Henan_3 tRNA-Phe
  7588. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Phe
  7589. Salmonella enterica subsp. enterica serovar Newport str. JY-221A-RVX tRNA-Phe
  7590. Salmonella enterica subsp. enterica serovar Newport str. JY-223A-RVX tRNA-Phe
  7591. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Phe
  7592. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Phe
  7593. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Phe
  7594. Salmonella enterica subsp. enterica serovar Newport str. MA_10EN1469 tRNA-Phe
  7595. Salmonella enterica subsp. enterica serovar Newport str. PL01 tRNA-Phe
  7596. Salmonella enterica subsp. enterica serovar Newport str. Pond080-2TTA tRNA-Phe
  7597. Salmonella enterica subsp. enterica serovar Newport str. PRS_2010_0624 tRNA-Phe
  7598. Salmonella enterica subsp. enterica serovar Newport str. RI_10P068 tRNA-Phe
  7599. Salmonella enterica subsp. enterica serovar Newport str. RI_10P069 tRNA-Phe
  7600. Salmonella enterica subsp. enterica serovar Newport str. RI_10P078 tRNA-Phe
  7601. Salmonella enterica subsp. enterica serovar Newport str. RI_10P079 tRNA-Phe
  7602. Salmonella enterica subsp. enterica serovar Newport str. S09097 tRNA-Phe
  7603. Salmonella enterica subsp. enterica serovar Newport str. S103RVX tRNA-Phe
  7604. Salmonella enterica subsp. enterica serovar Newport str. S-38A-RVX tRNA-Phe
  7605. Salmonella enterica subsp. enterica serovar Newport str. S-49A-RVX tRNA-Phe
  7606. Salmonella enterica subsp. enterica serovar Newport str. SH111077 tRNA-Phe
  7607. Salmonella enterica subsp. enterica serovar Newport str. Shandong_3 tRNA-Phe
  7608. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7609. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Phe
  7610. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Phe
  7611. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Phe
  7612. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Phe
  7613. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7614. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Phe
  7615. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Phe
  7616. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7617. Salmonella enterica subsp. enterica serovar Newport str. VA_R100506907 tRNA-Phe
  7618. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512570 tRNA-Phe
  7619. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512572 tRNA-Phe
  7620. Salmonella enterica subsp. enterica serovar Newport str. VA_R100804798 tRNA-Phe
  7621. Salmonella enterica subsp. enterica serovar Newport str. VA_R100808502 tRNA-Phe
  7622. Salmonella enterica subsp. enterica serovar Newport str. WA_14881 tRNA-Phe
  7623. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Phe
  7624. Salmonella enterica subsp. enterica serovar Newport str. WA_14885 tRNA-Phe
  7625. Salmonella enterica subsp. enterica serovar Newport str. WA_14900 tRNA-Phe
  7626. Salmonella enterica subsp. enterica serovar Newport serovar Newport tRNA-Phe
  7627. Salmonella enterica subsp. enterica serovar Newyork tRNA-Phe
  7628. Salmonella enterica subsp. enterica serovar Ngili tRNA-Phe
  7629. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Phe
  7630. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Phe
  7631. Salmonella enterica subsp. enterica serovar Nima tRNA-Phe
  7632. Salmonella enterica subsp. enterica serovar Nitra tRNA-Phe
  7633. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Phe
  7634. Salmonella enterica subsp. enterica serovar Norwich tRNA-Phe
  7635. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Phe
  7636. Salmonella enterica subsp. enterica serovar Noya tRNA-Phe
  7637. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Phe
  7638. Salmonella enterica subsp. enterica serovar Oakland tRNA-Phe
  7639. Salmonella enterica subsp. enterica serovar Obogu tRNA-Phe
  7640. Salmonella enterica subsp. enterica serovar Odozi tRNA-Phe
  7641. Salmonella enterica subsp. enterica serovar Offa tRNA-Phe
  7642. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Phe
  7643. Salmonella enterica subsp. enterica serovar Ohio tRNA-Phe
  7644. Salmonella enterica subsp. enterica serovar Okatie tRNA-Phe
  7645. Salmonella enterica subsp. enterica serovar Olten tRNA-Phe
  7646. Salmonella enterica subsp. enterica serovar Omderman tRNA-Phe
  7647. Salmonella enterica subsp. enterica serovar Omuna tRNA-Phe
  7648. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Phe
  7649. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Phe
  7650. Salmonella enterica subsp. enterica serovar Onireke tRNA-Phe
  7651. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Phe
  7652. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Phe
  7653. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Phe
  7654. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Phe
  7655. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Phe
  7656. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Phe
  7657. Salmonella enterica subsp. enterica serovar Orion tRNA-Phe
  7658. Salmonella enterica subsp. enterica serovar O Rough:a:- tRNA-Phe
  7659. Salmonella enterica subsp. enterica serovar O Rough:g,m:- tRNA-Phe
  7660. Salmonella enterica subsp. enterica serovar O Rough:H Nonmotile tRNA-Phe
  7661. Salmonella enterica subsp. enterica serovar O rough tRNA-Phe
  7662. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Phe
  7663. Salmonella enterica subsp. enterica serovar Oslo tRNA-Phe
  7664. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Phe
  7665. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Phe
  7666. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Phe
  7667. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Phe
  7668. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Phe
  7669. Salmonella enterica subsp. enterica serovar Overschie tRNA-Phe
  7670. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Phe
  7671. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Phe
  7672. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Phe
  7673. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Phe
  7674. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Phe
  7675. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Phe
  7676. Salmonella enterica subsp. enterica serovar Panama tRNA-Phe(gaa)
  7677. Salmonella enterica subsp. enterica serovar Papuana tRNA-Phe
  7678. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7679. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Phe
  7680. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7681. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Phe
  7682. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7683. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Phe
  7684. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Phe
  7685. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Phe
  7686. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Phe
  7687. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Phe
  7688. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Phe
  7689. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Phe
  7690. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000535 tRNA-Phe
  7691. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Phe
  7692. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000537 tRNA-Phe
  7693. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000539 tRNA-Phe
  7694. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Phe
  7695. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Phe
  7696. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Phe
  7697. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Phe
  7698. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000546 tRNA-Phe
  7699. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Phe
  7700. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Phe
  7701. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Phe
  7702. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Phe
  7703. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Phe
  7704. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Phe
  7705. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Phe
  7706. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7707. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Phe
  7708. Salmonella enterica subsp. enterica serovar Paratyphi B var. L-tartrate + tRNA-Phe
  7709. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Phe
  7710. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Phe
  7711. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Phe
  7712. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7713. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Phe(gaa)
  7714. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Phe
  7715. Salmonella enterica subsp. enterica serovar Pasing tRNA-Phe
  7716. Salmonella enterica subsp. enterica serovar Penarth tRNA-Phe
  7717. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Phe
  7718. Salmonella enterica subsp. enterica serovar Perth tRNA-Phe
  7719. Salmonella enterica subsp. enterica serovar Pisa tRNA-Phe
  7720. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Phe
  7721. Salmonella enterica subsp. enterica serovar Poano tRNA-Phe
  7722. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Phe
  7723. Salmonella enterica subsp. enterica serovar Pomona tRNA-Phe
  7724. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Phe
  7725. Salmonella enterica subsp. enterica serovar Poona tRNA-Phe(gaa)
  7726. Salmonella enterica subsp. enterica serovar Portland tRNA-Phe
  7727. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Phe
  7728. Salmonella enterica subsp. enterica serovar Praha tRNA-Phe
  7729. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Phe
  7730. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Phe
  7731. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Phe
  7732. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Phe
  7733. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Phe
  7734. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7735. Salmonella enterica subsp. enterica serovar Pullorum tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7736. Salmonella enterica subsp. enterica serovar Putten tRNA-Phe
  7737. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Phe
  7738. Salmonella enterica subsp. enterica serovar -:r:1,2 tRNA-Phe
  7739. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Phe
  7740. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Phe
  7741. Salmonella enterica subsp. enterica serovar Rauform tRNA-Phe
  7742. Salmonella enterica subsp. enterica serovar Reading subsp. enterica serovar Reading tRNA-Phe
  7743. Salmonella enterica subsp. enterica serovar Redba tRNA-Phe
  7744. Salmonella enterica subsp. enterica serovar Redlands tRNA-Phe
  7745. Salmonella enterica subsp. enterica serovar Regent tRNA-Phe
  7746. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Phe
  7747. Salmonella enterica subsp. enterica serovar Remo tRNA-Phe
  7748. Salmonella enterica subsp. enterica serovar Richmond tRNA-Phe
  7749. Salmonella enterica subsp. enterica serovar Rideau tRNA-Phe
  7750. Salmonella enterica subsp. enterica serovar Ridge tRNA-Phe
  7751. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Phe
  7752. Salmonella enterica subsp. enterica serovar Rissen serovar Rissen tRNA-Phe
  7753. Salmonella enterica subsp. enterica serovar Riverside tRNA-Phe
  7754. Salmonella enterica subsp. enterica serovar Rochdale tRNA-Phe
  7755. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Phe
  7756. Salmonella enterica subsp. enterica serovar Rostock tRNA-Phe
  7757. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Phe
  7758. Salmonella enterica subsp. enterica serovar Rough:a:e,n,x tRNA-Phe
  7759. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Phe
  7760. Salmonella enterica subsp. enterica serovar Rough:b:1,5 tRNA-Phe
  7761. Salmonella enterica subsp. enterica serovar Rough:e,h:1,5 tRNA-Phe
  7762. Salmonella enterica subsp. enterica serovar Rough:g,m:- tRNA-Phe
  7763. Salmonella enterica subsp. enterica serovar Rough:g,s,t:- tRNA-Phe
  7764. Salmonella enterica subsp. enterica serovar Rough:i:1,2 tRNA-Phe
  7765. Salmonella enterica subsp. enterica serovar Rough:m,t:- tRNA-Phe
  7766. Salmonella enterica subsp. enterica serovar Rough O:c:1,5 tRNA-Phe
  7767. Salmonella enterica subsp. enterica serovar Rough O:c:z tRNA-Phe
  7768. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Phe
  7769. Salmonella enterica subsp. enterica serovar Rough O:k:1,5 tRNA-Phe
  7770. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Phe
  7771. Salmonella enterica subsp. enterica serovar Rough O:z29 tRNA-Phe
  7772. Salmonella enterica subsp. enterica serovar Rough O:z4,z23: tRNA-Phe
  7773. Salmonella enterica subsp. enterica serovar Rough O:z4,z23:- tRNA-Phe
  7774. Salmonella enterica subsp. enterica serovar Rough:r:1,2 tRNA-Phe
  7775. Salmonella enterica subsp. enterica serovar Rough:r:1,5 tRNA-Phe
  7776. Salmonella enterica subsp. enterica serovar Rough:r:- tRNA-Phe
  7777. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Phe
  7778. Salmonella enterica subsp. enterica serovar Rough:-:- tRNA-Phe
  7779. Salmonella enterica subsp. enterica serovar Rough:z10:e,n,z15 tRNA-Phe
  7780. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Phe
  7781. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Phe
  7782. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Phe
  7783. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Phe
  7784. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Phe
  7785. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Phe
  7786. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Phe
  7787. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000610 tRNA-Phe
  7788. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Phe
  7789. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000615 tRNA-Phe
  7790. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Phe
  7791. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Phe
  7792. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004118 tRNA-Phe
  7793. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004119 tRNA-Phe
  7794. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004120 tRNA-Phe
  7795. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004123 tRNA-Phe
  7796. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004125 tRNA-Phe
  7797. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004126 tRNA-Phe
  7798. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004129 tRNA-Phe
  7799. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004131 tRNA-Phe
  7800. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004133 tRNA-Phe
  7801. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004135 tRNA-Phe
  7802. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004136 tRNA-Phe
  7803. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004137 tRNA-Phe
  7804. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004139 tRNA-Phe
  7805. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004140 tRNA-Phe
  7806. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004141 tRNA-Phe
  7807. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004142 tRNA-Phe
  7808. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004143 tRNA-Phe
  7809. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004144 tRNA-Phe
  7810. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004145 tRNA-Phe
  7811. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004146 tRNA-Phe
  7812. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004147 tRNA-Phe
  7813. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004149 tRNA-Phe
  7814. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004150 tRNA-Phe
  7815. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004152 tRNA-Phe
  7816. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004153 tRNA-Phe
  7817. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004154 tRNA-Phe
  7818. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004155 tRNA-Phe
  7819. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004156 tRNA-Phe
  7820. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004157 tRNA-Phe
  7821. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004158 tRNA-Phe
  7822. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004159 tRNA-Phe
  7823. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004160 tRNA-Phe
  7824. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004161 tRNA-Phe
  7825. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004163 tRNA-Phe
  7826. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004164 tRNA-Phe
  7827. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004165 tRNA-Phe
  7828. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004166 tRNA-Phe
  7829. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004188 tRNA-Phe
  7830. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004189 tRNA-Phe
  7831. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004190 tRNA-Phe
  7832. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004191 tRNA-Phe
  7833. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004192 tRNA-Phe
  7834. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004193 tRNA-Phe
  7835. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004194 tRNA-Phe
  7836. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004196 tRNA-Phe
  7837. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Phe
  7838. Salmonella enterica subsp. enterica serovar Saintpaul str. S-70 tRNA-Phe
  7839. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Phe
  7840. Salmonella enterica subsp. enterica serovar Saintpaul serovar Saintpaul tRNA-Phe
  7841. Salmonella enterica subsp. enterica serovar Salford tRNA-Phe
  7842. Salmonella enterica subsp. enterica serovar Sandiego serovar Sandiego tRNA-Phe
  7843. Salmonella enterica subsp. enterica serovar Sangalkam tRNA-Phe
  7844. Salmonella enterica subsp. enterica serovar Sangera tRNA-Phe
  7845. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-Phe(gaa)
  7846. Salmonella enterica subsp. enterica serovar Santiago tRNA-Phe
  7847. Salmonella enterica subsp. enterica serovar Saphra tRNA-Phe
  7848. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Phe
  7849. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Phe
  7850. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7851. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Phe
  7852. Salmonella enterica subsp. enterica serovar Seattle tRNA-Phe
  7853. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Phe
  7854. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Phe
  7855. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Phe
  7856. Salmonella enterica subsp. enterica serovar Sendai tRNA-Phe(gaa)
  7857. Salmonella enterica subsp. enterica serovar Senegal tRNA-Phe
  7858. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Phe
  7859. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Phe
  7860. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Phe
  7861. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Phe
  7862. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Phe
  7863. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Phe
  7864. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Phe
  7865. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN000622 tRNA-Phe
  7866. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004018 tRNA-Phe
  7867. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004019 tRNA-Phe
  7868. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004020 tRNA-Phe
  7869. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004021 tRNA-Phe
  7870. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004022 tRNA-Phe
  7871. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004023 tRNA-Phe
  7872. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Phe
  7873. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004026 tRNA-Phe
  7874. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004027 tRNA-Phe
  7875. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004028 tRNA-Phe
  7876. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004029 tRNA-Phe
  7877. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Phe
  7878. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Phe
  7879. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Phe
  7880. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Phe
  7881. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004034 tRNA-Phe
  7882. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004035 tRNA-Phe
  7883. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004036 tRNA-Phe
  7884. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004037 tRNA-Phe
  7885. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004041 tRNA-Phe
  7886. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004042 tRNA-Phe
  7887. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004043 tRNA-Phe
  7888. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004044 tRNA-Phe
  7889. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004045 tRNA-Phe
  7890. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004046 tRNA-Phe
  7891. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004047 tRNA-Phe
  7892. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004048 tRNA-Phe
  7893. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004049 tRNA-Phe
  7894. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004050 tRNA-Phe
  7895. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004052 tRNA-Phe
  7896. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004054 tRNA-Phe
  7897. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004055 tRNA-Phe
  7898. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004059 tRNA-Phe
  7899. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004060 tRNA-Phe
  7900. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004061 tRNA-Phe
  7901. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004062 tRNA-Phe
  7902. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004063 tRNA-Phe
  7903. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004064 tRNA-Phe
  7904. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004065 tRNA-Phe
  7905. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004066 tRNA-Phe
  7906. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004067 tRNA-Phe
  7907. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004068 tRNA-Phe
  7908. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004069 tRNA-Phe
  7909. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Phe
  7910. Salmonella enterica subsp. enterica serovar Senftenberg str. SS209 transfer RNA-Phe
  7911. Salmonella enterica subsp. enterica serovar Senftenberg subsp. enterica serovar Senftenberg tRNA-Phe(gaa)
  7912. Salmonella enterica subsp. enterica serovar Senneville tRNA-Phe
  7913. Salmonella enterica subsp. enterica serovar Shamba tRNA-Phe
  7914. Salmonella enterica subsp. enterica serovar Shubra tRNA-Phe
  7915. Salmonella enterica subsp. enterica serovar Singapore tRNA-Phe
  7916. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Phe
  7917. Salmonella enterica subsp. enterica serovar SI Rough:r:1,5 tRNA-Phe
  7918. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Phe
  7919. Salmonella enterica subsp. enterica serovar Soahanina tRNA-Phe
  7920. Salmonella enterica subsp. enterica serovar Soerenga str. 695 tRNA-Phe
  7921. Salmonella enterica subsp. enterica serovar Soerenga tRNA-Phe
  7922. Salmonella enterica subsp. enterica serovar Solt tRNA-Phe
  7923. Salmonella enterica subsp. enterica serovar Somone tRNA-Phe
  7924. Salmonella enterica subsp. enterica serovar Soumbedioune tRNA-Phe
  7925. Salmonella enterica subsp. enterica serovar Southampton tRNA-Phe
  7926. Salmonella enterica subsp. enterica serovar Southbank tRNA-Phe
  7927. Salmonella enterica subsp. enterica serovar Souza tRNA-Phe
  7928. Salmonella enterica subsp. enterica serovar Splott tRNA-Phe
  7929. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Phe
  7930. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Phe
  7931. Salmonella enterica subsp. enterica serovar Stanley tRNA-Phe(gaa)
  7932. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Phe
  7933. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Phe
  7934. Salmonella enterica subsp. enterica serovar Sternschanze tRNA-Phe
  7935. Salmonella enterica subsp. enterica serovar Sterrenbos tRNA-Phe
  7936. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Phe
  7937. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Phe
  7938. Salmonella enterica subsp. enterica serovar Strasbourg tRNA-Phe
  7939. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Phe
  7940. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Phe
  7941. Salmonella enterica subsp. enterica serovar Suberu tRNA-Phe
  7942. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Phe
  7943. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Phe
  7944. Salmonella enterica subsp. enterica serovar Szentes tRNA-Phe
  7945. Salmonella enterica subsp. enterica serovar Tado tRNA-Phe
  7946. Salmonella enterica subsp. enterica serovar Tafo tRNA-Phe
  7947. Salmonella enterica subsp. enterica serovar Taiping tRNA-Phe
  7948. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Phe
  7949. Salmonella enterica subsp. enterica serovar Taksony tRNA-Phe
  7950. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Phe
  7951. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Phe
  7952. Salmonella enterica subsp. enterica serovar Tamale tRNA-Phe
  7953. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Phe
  7954. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Phe
  7955. Salmonella enterica subsp. enterica serovar Tchad tRNA-Phe
  7956. Salmonella enterica subsp. enterica serovar Techimani tRNA-Phe
  7957. Salmonella enterica subsp. enterica serovar Teddington tRNA-Phe
  7958. Salmonella enterica subsp. enterica serovar Tees tRNA-Phe
  7959. Salmonella enterica subsp. enterica serovar Teko tRNA-Phe
  7960. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Phe
  7961. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Phe
  7962. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Phe
  7963. Salmonella enterica subsp. enterica serovar Teltow tRNA-Phe
  7964. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Phe
  7965. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Phe
  7966. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Phe
  7967. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Phe
  7968. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7969. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Phe
  7970. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Phe
  7971. Salmonella enterica subsp. enterica serovar Teshie tRNA-Phe
  7972. Salmonella enterica subsp. enterica serovar Texas tRNA-Phe
  7973. Salmonella enterica subsp. enterica serovar Thetford tRNA-Phe
  7974. Salmonella enterica subsp. enterica serovar Thomasville subsp. enterica serovar Thomasville tRNA-Phe
  7975. Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 tRNA-Phe
  7976. Salmonella enterica subsp. enterica serovar Thompson str. CFSAN000625 tRNA-Phe
  7977. Salmonella enterica subsp. enterica serovar Thompson str. RM6836 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7978. Salmonella enterica subsp. enterica serovar Thompson serovar Thompson tRNA-Phe(gaa)
  7979. Salmonella enterica subsp. enterica serovar Tilburg tRNA-Phe
  7980. Salmonella enterica subsp. enterica serovar Tilene tRNA-Phe
  7981. Salmonella enterica subsp. enterica serovar Togba tRNA-Phe
  7982. Salmonella enterica subsp. enterica serovar Tornow tRNA-Phe
  7983. Salmonella enterica subsp. enterica serovar Toucra tRNA-Phe
  7984. Salmonella enterica subsp. enterica serovar Toulon tRNA-Phe
  7985. Salmonella enterica subsp. enterica serovar Treforest tRNA-Phe
  7986. Salmonella enterica subsp. enterica serovar Tshiongwe tRNA-Phe
  7987. Salmonella enterica subsp. enterica serovar Tucson tRNA-Phe
  7988. Salmonella enterica subsp. enterica serovar Tudu tRNA-Phe
  7989. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Phe
  7990. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Phe
  7991. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Phe
  7992. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7993. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Phe
  7994. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Phe
  7995. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Phe
  7996. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  7997. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Phe
  7998. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Phe
  7999. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Phe
  8000. Salmonella enterica subsp. enterica serovar Typhimurium str. ATCC 14028 tRNA-Phe
  8001. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Phe
  8002. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Phe
  8003. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Phe
  8004. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Phe
  8005. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Phe
  8006. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Phe
  8007. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Phe
  8008. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Phe
  8009. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Phe
  8010. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8011. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Phe
  8012. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Phe
  8013. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000634 tRNA-Phe
  8014. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000643 tRNA-Phe
  8015. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Phe
  8016. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Phe
  8017. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8018. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8019. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8020. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8021. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Phe
  8022. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Phe
  8023. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8024. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Phe
  8025. Salmonella enterica subsp. enterica serovar Typhimurium str. SJ2353 tRNA-Phe
  8026. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8027. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Phe
  8028. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Phe
  8029. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8030. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Phe
  8031. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Phe
  8032. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Phe
  8033. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Phe
  8034. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Phe
  8035. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Phe
  8036. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Phe
  8037. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Phe
  8038. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Phe
  8039. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Phe
  8040. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Phe
  8041. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Phe
  8042. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8043. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8044. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8045. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Phe
  8046. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Phe
  8047. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Phe
  8048. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Phe
  8049. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Phe
  8050. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8051. Salmonella enterica subsp. enterica serovar Typhimurium serovar Typhimurium tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8052. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8053. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Phe
  8054. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Phe
  8055. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Phe
  8056. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Phe
  8057. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Phe
  8058. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic tRNA-Phe
  8059. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Phe
  8060. Salmonella enterica subsp. enterica serovar Typhi str. AG3 tRNA-Phe
  8061. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Phe
  8062. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Phe
  8063. Salmonella enterica subsp. enterica serovar Typhi str. CR0044 tRNA-Phe
  8064. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8065. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8066. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Phe
  8067. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8068. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  8069. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Phe
  8070. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000655 tRNA-Phe
  8071. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Phe(gaa)
  8072. Salmonella enterica subsp. enterica serovar Typhi tRNA-Phe(gaa)
  8073. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Phe
  8074. Salmonella enterica subsp. enterica serovar Uccle tRNA-Phe
  8075. Salmonella enterica subsp. enterica serovar Uganda subsp. enterica serovar Uganda tRNA-Phe
  8076. Salmonella enterica subsp. enterica serovar Uganda var. 15+ tRNA-Phe
  8077. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Phe
  8078. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Phe
  8079. Salmonella enterica subsp. enterica serovar Umbadah tRNA-Phe
  8080. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Phe
  8081. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Phe
  8082. Salmonella enterica subsp. enterica serovar Urbana str. ATCC 9261 tRNA-Phe
  8083. Salmonella enterica subsp. enterica serovar Urbana tRNA-Phe
  8084. Salmonella enterica subsp. enterica serovar Utah tRNA-Phe
  8085. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Phe
  8086. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Phe
  8087. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Phe
  8088. Salmonella enterica subsp. enterica serovar Vejle tRNA-Phe
  8089. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Phe
  8090. Salmonella enterica subsp. enterica serovar Victoria tRNA-Phe
  8091. Salmonella enterica subsp. enterica serovar Vietnam tRNA-Phe
  8092. Salmonella enterica subsp. enterica serovar Vilvoorde tRNA-Phe
  8093. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Phe
  8094. Salmonella enterica subsp. enterica serovar Virchow str. ATCC 51955 tRNA-Phe
  8095. Salmonella enterica subsp. enterica serovar Virchow str. SVQ1 tRNA-Phe
  8096. Salmonella enterica subsp. enterica serovar Virchow serovar Virchow tRNA-Phe
  8097. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Phe
  8098. Salmonella enterica subsp. enterica serovar Virginia tRNA-Phe
  8099. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Phe
  8100. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Phe
  8101. Salmonella enterica subsp. enterica serovar Vom tRNA-Phe
  8102. Salmonella enterica subsp. enterica serovar Vridi tRNA-Phe
  8103. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Phe
  8104. Salmonella enterica subsp. enterica serovar Waedenswil tRNA-Phe
  8105. Salmonella enterica subsp. enterica serovar Wagadugu tRNA-Phe
  8106. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Phe
  8107. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Phe
  8108. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Phe
  8109. Salmonella enterica subsp. enterica serovar Wangata tRNA-Phe
  8110. Salmonella enterica subsp. enterica serovar Waral tRNA-Phe
  8111. Salmonella enterica subsp. enterica serovar Warnow tRNA-Phe
  8112. Salmonella enterica subsp. enterica serovar Warragul tRNA-Phe
  8113. Salmonella enterica subsp. enterica serovar Washington tRNA-Phe
  8114. Salmonella enterica subsp. enterica serovar Wa tRNA-Phe
  8115. Salmonella enterica subsp. enterica serovar Waycross tRNA-Phe
  8116. Salmonella enterica subsp. enterica serovar Wedding tRNA-Phe
  8117. Salmonella enterica subsp. enterica serovar Welikade tRNA-Phe
  8118. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Phe
  8119. Salmonella enterica subsp. enterica serovar Weltevreden str. 2007-60-3289-1 tRNA-Phe
  8120. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Phe(gaa)
  8121. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Phe
  8122. Salmonella enterica subsp. enterica serovar Wernigerode tRNA-Phe
  8123. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Phe
  8124. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Phe
  8125. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Phe
  8126. Salmonella enterica subsp. enterica serovar Westminster tRNA-Phe
  8127. Salmonella enterica subsp. enterica serovar Weston tRNA-Phe
  8128. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Phe
  8129. Salmonella enterica subsp. enterica serovar Wichita tRNA-Phe
  8130. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Phe
  8131. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Phe
  8132. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Phe
  8133. Salmonella enterica subsp. enterica serovar Wien tRNA-Phe
  8134. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Phe
  8135. Salmonella enterica subsp. enterica serovar Wimborne tRNA-Phe
  8136. Salmonella enterica subsp. enterica serovar Windermere tRNA-Phe
  8137. Salmonella enterica subsp. enterica serovar Winslow tRNA-Phe
  8138. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Phe
  8139. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Phe
  8140. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Phe
  8141. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Phe
  8142. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3008 tRNA-Phe
  8143. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3194 tRNA-Phe
  8144. Salmonella enterica subsp. enterica serovar Worthington str. BCH-4719 tRNA-Phe
  8145. Salmonella enterica subsp. enterica serovar Worthington str. BCH-5715 tRNA-Phe
  8146. Salmonella enterica subsp. enterica serovar Worthington str. BCH-7253 tRNA-Phe
  8147. Salmonella enterica subsp. enterica serovar Worthington tRNA-Phe
  8148. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Phe
  8149. Salmonella enterica subsp. enterica serovar Yaba tRNA-Phe
  8150. Salmonella enterica subsp. enterica serovar Yarrabah tRNA-Phe
  8151. Salmonella enterica subsp. enterica serovar Yolo tRNA-Phe
  8152. Salmonella enterica subsp. enterica serovar Yopougon tRNA-Phe
  8153. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Phe
  8154. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Phe
  8155. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Phe
  8156. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Phe
  8157. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Phe
  8158. Salmonella enterica subsp. enterica serovar Zega tRNA-Phe
  8159. Salmonella enterica subsp. enterica serovar Zongo tRNA-Phe
  8160. Salmonella enterica subsp. enterica str. CFSAN004167 tRNA-Phe
  8161. Salmonella enterica subsp. enterica tRNA-Phe(gaa)
  8162. Salmonella enterica subsp. houtenae serovar 1,40:g,z51:- tRNA-Phe
  8163. Salmonella enterica subsp. houtenae serovar [1],40:z4,z23:- tRNA-Phe
  8164. Salmonella enterica subsp. houtenae serovar 1,40:z4,z23:- tRNA-Phe
  8165. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Phe
  8166. Salmonella enterica subsp. houtenae serovar 16:z4,z23:- tRNA-Phe
  8167. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Phe
  8168. Salmonella enterica subsp. houtenae serovar 16:z4,z32:-- tRNA-Phe
  8169. Salmonella enterica subsp. houtenae serovar 17:z29:- tRNA-Phe
  8170. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Phe
  8171. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Phe
  8172. Salmonella enterica subsp. houtenae serovar 38:z4,z23:- tRNA-Phe
  8173. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Phe
  8174. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Phe
  8175. Salmonella enterica subsp. houtenae serovar 41:z29:- tRNA-Phe
  8176. Salmonella enterica subsp. houtenae serovar 41:z36:- tRNA-Phe
  8177. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Phe
  8178. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Phe
  8179. Salmonella enterica subsp. houtenae serovar Houten tRNA-Phe
  8180. Salmonella enterica subsp. houtenae serovar 43:z4:z23:- tRNA-Phe
  8181. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Phe
  8182. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Phe
  8183. Salmonella enterica subsp. houtenae serovar 44:z36,Z38:- tRNA-Phe
  8184. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Phe
  8185. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Phe
  8186. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Phe
  8187. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Phe
  8188. Salmonella enterica subsp. houtenae serovar 47:z36:- tRNA-Phe
  8189. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Phe
  8190. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Phe
  8191. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Phe
  8192. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Phe
  8193. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Phe
  8194. Salmonella enterica subsp. houtenae serovar 51:z4,z23:- tRNA-Phe
  8195. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Phe
  8196. Salmonella enterica subsp. houtenae serovar 57:z4,z23:- tRNA-Phe
  8197. Salmonella enterica subsp. houtenae serovar 6,7:z4,z24:- tRNA-Phe
  8198. Salmonella enterica subsp. houtenae serovar Houten tRNA-Phe(gaa)
  8199. Salmonella enterica subsp. houtenae serovar O:11:g,z25:- tRNA-Phe
  8200. Salmonella enterica subsp. houtenae serovar O:57:z4,z32:- tRNA-Phe
  8201. Salmonella enterica subsp. houtenae serovar Rough:z4,z23:- tRNA-Phe
  8202. Salmonella enterica subsp. houtenae str. ATCC BAA-1581 tRNA-Phe
  8203. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Phe
  8204. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Phe
  8205. Salmonella enterica subsp. houtenae tRNA-Phe(gaa)
  8206. Salmonella enterica subsp. indica serovar 11:b:e,n,x tRNA-Phe
  8207. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Phe
  8208. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Phe
  8209. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Phe
  8210. Salmonella enterica subsp. indica serovar 6,7:z41:1,7 tRNA-Phe
  8211. Salmonella enterica subsp. indica serovar Marseille tRNA-Phe
  8212. Salmonella enterica subsp. indica tRNA-Phe(gaa)
  8213. Salmonella enterica subsp. salamae serovar 13,22:z:- tRNA-Phe
  8214. Salmonella enterica subsp. salamae serovar [1],40:z35:e,n,x,z15 tRNA-Phe
  8215. Salmonella enterica subsp. salamae serovar 1,4,12,[27]:b:[e,n,x] tRNA-Phe
  8216. Salmonella enterica subsp. salamae serovar 16:m,t:e,n,x tRNA-Phe
  8217. Salmonella enterica subsp. salamae serovar 16:m,t:- tRNA-Phe
  8218. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Phe
  8219. Salmonella enterica subsp. salamae serovar 21:f,g,t:- tRNA-Phe
  8220. Salmonella enterica subsp. salamae serovar 21:z10:z6 tRNA-Phe
  8221. Salmonella enterica subsp. salamae serovar 21:z10:[z6] tRNA-Phe
  8222. Salmonella enterica subsp. salamae serovar 28:r:e,n,z15 tRNA-Phe
  8223. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Phe
  8224. Salmonella enterica subsp. salamae serovar 30:g,m,s:e,n,x tRNA-Phe
  8225. Salmonella enterica subsp. salamae serovar 30:m,t:- tRNA-Phe
  8226. Salmonella enterica subsp. salamae serovar 3,10:b:e,n,x tRNA-Phe
  8227. Salmonella enterica subsp. salamae serovar 35:g,m,s,t:- tRNA-Phe
  8228. Salmonella enterica subsp. salamae serovar 39:c:e,n,x tRNA-Phe
  8229. Salmonella enterica subsp. salamae serovar 40:a:z39 tRNA-Phe
  8230. Salmonella enterica subsp. salamae serovar 40:c:e,n,x,z15 tRNA-Phe
  8231. Salmonella enterica subsp. salamae serovar 40:c:z6 tRNA-Phe
  8232. Salmonella enterica subsp. salamae serovar 4,12:e,n,x:1,6 tRNA-Phe
  8233. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Phe
  8234. Salmonella enterica subsp. salamae serovar 42:b:e,n,x,z15 tRNA-Phe
  8235. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Phe
  8236. Salmonella enterica subsp. salamae serovar 42:g,t:- tRNA-Phe
  8237. Salmonella enterica subsp. salamae serovar 42:r:- tRNA-Phe
  8238. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Phe
  8239. Salmonella enterica subsp. salamae serovar 42:z29:- tRNA-Phe
  8240. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Phe
  8241. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Phe
  8242. Salmonella enterica subsp. salamae serovar 47:b:e,n,x,z15 tRNA-Phe
  8243. Salmonella enterica subsp. salamae serovar 47:z:e,n,x,z15 tRNA-Phe
  8244. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Phe
  8245. Salmonella enterica subsp. salamae serovar 48:z81:z39 tRNA-Phe
  8246. Salmonella enterica subsp. salamae serovar 48:z:e,n,x,z15 tRNA-Phe
  8247. Salmonella enterica subsp. salamae serovar 50:b:z6 tRNA-Phe
  8248. Salmonella enterica subsp. salamae serovar 51:c:- tRNA-Phe
  8249. Salmonella enterica subsp. salamae serovar 52:z:z39 tRNA-Phe
  8250. Salmonella enterica subsp. salamae serovar 53:z4,z24:- tRNA-Phe
  8251. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Phe
  8252. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Phe
  8253. Salmonella enterica subsp. salamae serovar 56:l,v:z39 tRNA-Phe
  8254. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Phe
  8255. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x tRNA-Phe
  8256. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Phe
  8257. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Phe
  8258. Salmonella enterica subsp. salamae serovar 58:a:z6 tRNA-Phe
  8259. Salmonella enterica subsp. salamae serovar 58:c:z6 tRNA-Phe
  8260. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Phe
  8261. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Phe
  8262. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Phe
  8263. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Phe
  8264. Salmonella enterica subsp. salamae serovar 60:z10:z39 tRNA-Phe
  8265. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Phe
  8266. Salmonella enterica subsp. salamae serovar 6,7:z:1,5 tRNA-Phe
  8267. Salmonella enterica subsp. salamae serovar 9,46:l,w:e,n,x tRNA-Phe
  8268. Salmonella enterica subsp. salamae serovar 9,46:z4,z24:z39:z42 tRNA-Phe
  8269. Salmonella enterica subsp. salamae serovar Greenside tRNA-Phe
  8270. Salmonella enterica subsp. salamae serovar Sofia tRNA-Phe
  8271. Salmonella enterica subsp. salamae serovar Springs tRNA-Phe
  8272. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Phe
  8273. Salmonella enterica subsp. salamae tRNA-Phe(gaa)
  8274. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Phe
  8275. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Phe
  8276. Salmonella enterica subsp. VII str. CFSAN000550 tRNA-Phe
  8277. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Phe
  8278. Salmonella enterica subsp. londinensis transfer RNA-Phe
  8279. Salmonella enterica tRNA-Phe(gaa)
  8280. Salmonella sp. 117 tRNA-Phe
  8281. Salmonella sp. 139 tRNA-Phe
  8282. Salmonella sp. 140 tRNA-Phe
  8283. Salmonella sp. 147 tRNA-Phe
  8284. Salmonella sp. 14ESS1015 tRNA-Phe
  8285. Salmonella sp. 14ESS1282 tRNA-Phe
  8286. Salmonella sp. 14ESS1484 tRNA-Phe
  8287. Salmonella sp. 14ESS1566 tRNA-Phe
  8288. Salmonella sp. 14ESS1724 tRNA-Phe
  8289. Salmonella sp. 15E126 tRNA-Phe
  8290. Salmonella sp. 15E133 tRNA-Phe
  8291. Salmonella sp. 15E179 tRNA-Phe
  8292. Salmonella sp. 15E227 tRNA-Phe
  8293. Salmonella sp. 15E399 tRNA-Phe
  8294. Salmonella sp. 15E418 tRNA-Phe
  8295. Salmonella sp. 15E51 tRNA-Phe
  8296. Salmonella sp. 15E557 tRNA-Phe
  8297. Salmonella sp. 15E65 tRNA-Phe
  8298. Salmonella sp. 15E66 tRNA-Phe
  8299. Salmonella sp. 162 tRNA-Phe
  8300. Salmonella sp. 163 tRNA-Phe
  8301. Salmonella sp. 16E108 tRNA-Phe
  8302. Salmonella sp. 16E136 tRNA-Phe
  8303. Salmonella sp. 16E257 tRNA-Phe
  8304. Salmonella sp. 16E421 tRNA-Phe
  8305. Salmonella sp. 16E460 tRNA-Phe
  8306. Salmonella sp. 174 tRNA-Phe
  8307. Salmonella sp. 17E11 tRNA-Phe
  8308. Salmonella sp. 17E42 tRNA-Phe
  8309. Salmonella sp. 17E465 tRNA-Phe
  8310. Salmonella sp. 17E530 tRNA-Phe
  8311. Salmonella sp. 17E594 tRNA-Phe
  8312. Salmonella sp. 17E603 tRNA-Phe
  8313. Salmonella sp. 17E623 tRNA-Phe
  8314. Salmonella sp. 17E624 tRNA-Phe
  8315. Salmonella sp. 17E74 tRNA-Phe
  8316. Salmonella sp. 1949 tRNA-Phe
  8317. Salmonella sp. 2018103 tRNA-Phe
  8318. Salmonella sp. 2018-SM11 tRNA-Phe
  8319. Salmonella sp. 2018-SM452 tRNA-Phe
  8320. Salmonella sp. 2018-SM64 tRNA-Phe
  8321. Salmonella sp. 2018-SM800 tRNA-Phe
  8322. Salmonella sp. 2018-SM916 tRNA-Phe
  8323. Salmonella sp. 2018-SM963 tRNA-Phe
  8324. Salmonella sp. 2019-SM258 tRNA-Phe
  8325. Salmonella sp. 2019-SM259 tRNA-Phe
  8326. Salmonella sp. 2019-SM265 tRNA-Phe
  8327. Salmonella sp. 2021-108 tRNA-Phe
  8328. Salmonella sp. 2021-117 tRNA-Phe
  8329. Salmonella sp. 2021-161 tRNA-Phe
  8330. Salmonella sp. 2021-174 tRNA-Phe
  8331. Salmonella sp. 2021-33 tRNA-Phe
  8332. Salmonella sp. 2021-43 tRNA-Phe
  8333. Salmonella sp. 2021-64 tRNA-Phe
  8334. Salmonella sp. 2094 tRNA-Phe
  8335. Salmonella sp. 2101 tRNA-Phe
  8336. Salmonella sp. 2184 tRNA-Phe
  8337. Salmonella sp. 21CR6302 tRNA-Phe
  8338. Salmonella sp. 2254 tRNA-Phe
  8339. Salmonella sp. 2267 tRNA-Phe
  8340. Salmonella sp. 2269 tRNA-Phe
  8341. Salmonella sp. 237J8 tRNA-Phe
  8342. Salmonella sp. 23CR6032 tRNA-Phe
  8343. Salmonella sp. 2564 tRNA-Phe
  8344. Salmonella sp. 2591 tRNA-Phe
  8345. Salmonella sp. 2613 tRNA-Phe
  8346. Salmonella sp. 2625 tRNA-Phe
  8347. Salmonella sp. 32010201201800099SM tRNA-Phe
  8348. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Phe
  8349. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Phe
  8350. Salmonella sp. 32010601201600049SM tRNA-Phe
  8351. Salmonella sp. 32010601201600067SM tRNA-Phe
  8352. Salmonella sp. 32010601201800023SM tRNA-Phe
  8353. Salmonella sp. 32010601201800030SM tRNA-Phe
  8354. Salmonella sp. 32011103201800031SM tRNA-Phe
  8355. Salmonella sp. 32011103201800106SM tRNA-Phe
  8356. Salmonella sp. 32011401201800036SM tRNA-Phe
  8357. Salmonella sp. 32011401-201800074SM tRNA-Phe
  8358. Salmonella sp. 32011501201800079SM tRNA-Phe
  8359. Salmonella sp. 32011602201600097SM tRNA-Phe
  8360. Salmonella sp. 32011602201600105SM tRNA-Phe
  8361. Salmonella sp. 32011602201800010SM tRNA-Phe
  8362. Salmonella sp. 32011602201800014SM tRNA-Phe
  8363. Salmonella sp. 32011801201800027SM tRNA-Phe
  8364. Salmonella sp. 32020114201800008SM tRNA-Phe
  8365. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Phe
  8366. Salmonella sp. 32020210201800012SM tRNA-Phe
  8367. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Phe
  8368. Salmonella sp. 32020501-2015-00069-FB-01-SM-01 tRNA-Phe
  8369. Salmonella sp. 32020501-2019-00039 tRNA-Phe
  8370. Salmonella sp. 32020501-2019-00040 tRNA-Phe
  8371. Salmonella sp. 32020501-2019-00041 tRNA-Phe
  8372. Salmonella sp. 32020501-2019-00044 tRNA-Phe
  8373. Salmonella sp. 32020501-2019-00050 tRNA-Phe
  8374. Salmonella sp. 32020501-2019-00052 tRNA-Phe
  8375. Salmonella sp. 32020509201800054SM tRNA-Phe
  8376. Salmonella sp. 32020509201800068SM tRNA-Phe
  8377. Salmonella sp. 32020512-2019-00017 tRNA-Phe
  8378. Salmonella sp. 32020614-2019-00048 tRNA-Phe
  8379. Salmonella sp. 32021105201800037SM tRNA-Phe
  8380. Salmonella sp. 32031101201600128SM tRNA-Phe
  8381. Salmonella sp. 3203110320150095SM tRNA-Phe
  8382. Salmonella sp. 3203110320150106SM tRNA-Phe
  8383. Salmonella sp. 32031103201600220SM tRNA-Phe
  8384. Salmonella sp. 32031103201600241SM tRNA-Phe
  8385. Salmonella sp. 32031103201600284SM tRNA-Phe
  8386. Salmonella sp. 32031103201600383SM tRNA-Phe
  8387. Salmonella sp. 3203110320160044 tRNA-Phe
  8388. Salmonella sp. 3203110320160052 tRNA-Phe
  8389. Salmonella sp. 3203110320160127 tRNA-Phe
  8390. Salmonella sp. 3203110320160165 tRNA-Phe
  8391. Salmonella sp. 3203110320160211 tRNA-Phe
  8392. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Phe
  8393. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Phe
  8394. Salmonella sp. 32040202-2015-00022-FB-01-SM-01 tRNA-Phe
  8395. Salmonella sp. 32040203201700040FB01SM01 tRNA-Phe
  8396. Salmonella sp. 32040203201700113FB01SM01 tRNA-Phe
  8397. Salmonella sp. 32040203-2019-00004 tRNA-Phe
  8398. Salmonella sp. 32040203-2019-00032 tRNA-Phe
  8399. Salmonella sp. 32040203-2019-00058 tRNA-Phe
  8400. Salmonella sp. 32040203-2019-00061 tRNA-Phe
  8401. Salmonella sp. 32040203-2019-00097 tRNA-Phe
  8402. Salmonella sp. 32040203-2019-00118 tRNA-Phe
  8403. Salmonella sp. 32040203-2019-00127 tRNA-Phe
  8404. Salmonella sp. 32040203-2019-00133 tRNA-Phe
  8405. Salmonella sp. 32040203-2019-00159 tRNA-Phe
  8406. Salmonella sp. 32040203-2019-00173 tRNA-Phe
  8407. Salmonella sp. 32040209201700048FB01SM01 tRNA-Phe
  8408. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Phe
  8409. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Phe
  8410. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Phe
  8411. Salmonella sp. 32070006-2019-00075 tRNA-Phe
  8412. Salmonella sp. 32070301201500052SM tRNA-Phe
  8413. Salmonella sp. 32070601201500089SM tRNA-Phe
  8414. Salmonella sp. 32070601201800144SM tRNA-Phe
  8415. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Phe
  8416. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Phe
  8417. Salmonella sp. 32082101201600294FB01SM01 tRNA-Phe
  8418. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Phe
  8419. Salmonella sp. 32082101-2019-00528 tRNA-Phe
  8420. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Phe
  8421. Salmonella sp. 32100201201700021SM tRNA-Phe
  8422. Salmonella sp. 32100201201700044SM tRNA-Phe
  8423. Salmonella sp. 32100201201700098SM tRNA-Phe
  8424. Salmonella sp. 32100201201700099SM tRNA-Phe
  8425. Salmonella sp. 32100201201700133SM tRNA-Phe
  8426. Salmonella sp. 32100202201700047SM tRNA-Phe
  8427. Salmonella sp. 32100202201700100SM tRNA-Phe
  8428. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Phe
  8429. Salmonella sp. 32118201201500025SM tRNA-Phe
  8430. Salmonella sp. 32120201201500036SM tRNA-Phe
  8431. Salmonella sp. 32120201201600049SM tRNA-Phe
  8432. Salmonella sp. 32120201201600070SM tRNA-Phe
  8433. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Phe
  8434. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Phe
  8435. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Phe
  8436. Salmonella sp. 32120202201500105SM tRNA-Phe
  8437. Salmonella sp. 32120202201500174SM tRNA-Phe
  8438. Salmonella sp. 32120202201600072SM tRNA-Phe
  8439. Salmonella sp. 32120202201600097SM tRNA-Phe
  8440. Salmonella sp. 32120202201600158SM tRNA-Phe
  8441. Salmonella sp. 32120203201500024SM tRNA-Phe
  8442. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Phe
  8443. Salmonella sp. 32130201201500050SM tRNA-Phe
  8444. Salmonella sp. 32130201-2017-00038SM tRNA-Phe
  8445. Salmonella sp. 32132402-2017-00107SM tRNA-Phe
  8446. Salmonella sp. 3C tRNA-Phe
  8447. Salmonella sp. 3DZ2-4SM tRNA-Phe
  8448. Salmonella sp. 50 tRNA-Phe
  8449. Salmonella sp. 741265044_PST tRNA-Phe
  8450. Salmonella sp. 741265045_PSA tRNA-Phe
  8451. Salmonella sp. 741265046_PSA tRNA-Phe
  8452. Salmonella sp. 741265047_PSA tRNA-Phe
  8453. Salmonella sp. 741265048_PSA tRNA-Phe
  8454. Salmonella sp. 741265049_HSA tRNA-Phe
  8455. Salmonella sp. 741265050_HSA tRNA-Phe
  8456. Salmonella sp. 741265051_HSA tRNA-Phe
  8457. Salmonella sp. 741265052_HSA tRNA-Phe
  8458. Salmonella sp. 741265053_HBA tRNA-Phe
  8459. Salmonella sp. 741265054_HSA tRNA-Phe
  8460. Salmonella sp. 741265055_HSA tRNA-Phe
  8461. Salmonella sp. 741265056_HSA tRNA-Phe
  8462. Salmonella sp. 741265057_PSA tRNA-Phe
  8463. Salmonella sp. 741265058_CST tRNA-Phe
  8464. Salmonella sp. 741265059_PSA tRNA-Phe
  8465. Salmonella sp. 741265060_HSA tRNA-Phe
  8466. Salmonella sp. 741265061_PSA tRNA-Phe
  8467. Salmonella sp. 741265062_PST tRNA-Phe
  8468. Salmonella sp. 741265063_PST tRNA-Phe
  8469. Salmonella sp. 741265064_HSA tRNA-Phe
  8470. Salmonella sp. 741265065_PSA tRNA-Phe
  8471. Salmonella sp. 741265066_PST tRNA-Phe
  8472. Salmonella sp. 741265067_HSA tRNA-Phe
  8473. Salmonella sp. 741265068_HSA tRNA-Phe
  8474. Salmonella sp. 741265069_HSA tRNA-Phe
  8475. Salmonella sp. 741265070_HSA tRNA-Phe
  8476. Salmonella sp. 741265071_PSA tRNA-Phe
  8477. Salmonella sp. 741265072_HSA tRNA-Phe
  8478. Salmonella sp. 741265073_HBA tRNA-Phe
  8479. Salmonella sp. 741265074_HSA tRNA-Phe
  8480. Salmonella sp. 741265075_HBA tRNA-Phe
  8481. Salmonella sp. 741265076_HSA tRNA-Phe
  8482. Salmonella sp. 741265077_HSA tRNA-Phe
  8483. Salmonella sp. 741265078_PSA tRNA-Phe
  8484. Salmonella sp. 741265079_HSA tRNA-Phe
  8485. Salmonella sp. 741265080_HBA tRNA-Phe
  8486. Salmonella sp. 741265081_PST tRNA-Phe
  8487. Salmonella sp. 741265082_HSA tRNA-Phe
  8488. Salmonella sp. 741265083_PST tRNA-Phe
  8489. Salmonella sp. 741265084_PSA tRNA-Phe
  8490. Salmonella sp. 741265085_HSA tRNA-Phe
  8491. Salmonella sp. 741265086_PSA tRNA-Phe
  8492. Salmonella sp. 741265087_PSA tRNA-Phe
  8493. Salmonella sp. 741265088_HSA tRNA-Phe
  8494. Salmonella sp. 741265089_PSA tRNA-Phe
  8495. Salmonella sp. 741265090_PSA tRNA-Phe
  8496. Salmonella sp. 741265091_HSA tRNA-Phe
  8497. Salmonella sp. 741265092_HBA tRNA-Phe
  8498. Salmonella sp. 741265093_PST tRNA-Phe
  8499. Salmonella sp. 741265094_HSA tRNA-Phe
  8500. Salmonella sp. 741265095_HST tRNA-Phe
  8501. Salmonella sp. 741265096_HSA tRNA-Phe
  8502. Salmonella sp. 741265097_PSA tRNA-Phe
  8503. Salmonella sp. 741265098_PSA tRNA-Phe
  8504. Salmonella sp. 741265099_HSA tRNA-Phe
  8505. Salmonella sp. 741265100_HSA tRNA-Phe
  8506. Salmonella sp. 741265101_HBA tRNA-Phe
  8507. Salmonella sp. 741265102_HBA tRNA-Phe
  8508. Salmonella sp. 741265103_PSA tRNA-Phe
  8509. Salmonella sp. 741265104_PSA tRNA-Phe
  8510. Salmonella sp. 741265105_PST tRNA-Phe
  8511. Salmonella sp. 741265106_PSA tRNA-Phe
  8512. Salmonella sp. 741265107_PSA tRNA-Phe
  8513. Salmonella sp. 741265108_PSA tRNA-Phe
  8514. Salmonella sp. 741265109_PST tRNA-Phe
  8515. Salmonella sp. 741265110_PST tRNA-Phe
  8516. Salmonella sp. 741265111_PSA tRNA-Phe
  8517. Salmonella sp. 741265112_PSA tRNA-Phe
  8518. Salmonella sp. 741265113_PSA tRNA-Phe
  8519. Salmonella sp. 741265114_PSA tRNA-Phe
  8520. Salmonella sp. 741265115_PSA tRNA-Phe
  8521. Salmonella sp. 741265116_PST tRNA-Phe
  8522. Salmonella sp. 741265118_HBA tRNA-Phe
  8523. Salmonella sp. 741265119_HSA tRNA-Phe
  8524. Salmonella sp. 741265120_PSA tRNA-Phe
  8525. Salmonella sp. 741265121_PSA tRNA-Phe
  8526. Salmonella sp. 741265122_HBA tRNA-Phe
  8527. Salmonella sp. 741265124_HBA tRNA-Phe
  8528. Salmonella sp. 741265125_PSA tRNA-Phe
  8529. Salmonella sp. 741265126_PSA tRNA-Phe
  8530. Salmonella sp. 741265127_PST tRNA-Phe
  8531. Salmonella sp. 741265128_PSA tRNA-Phe
  8532. Salmonella sp. 741265129_HBA tRNA-Phe
  8533. Salmonella sp. 741265130_HBA tRNA-Phe
  8534. Salmonella sp. 741265131_HSA tRNA-Phe
  8535. Salmonella sp. 741265132_CST tRNA-Phe
  8536. Salmonella sp. 741265134_HSA tRNA-Phe
  8537. Salmonella sp. 741265135_HSA tRNA-Phe
  8538. Salmonella sp. 741265136_HSA tRNA-Phe
  8539. Salmonella sp. 741265137_PSA tRNA-Phe
  8540. Salmonella sp. 741265138_PSA tRNA-Phe
  8541. Salmonella sp. 741265139_PSA tRNA-Phe
  8542. Salmonella sp. 741265140_PSA tRNA-Phe
  8543. Salmonella sp. 741265141_HSA tRNA-Phe
  8544. Salmonella sp. 741265142_PST tRNA-Phe
  8545. Salmonella sp. 741265143_HSA tRNA-Phe
  8546. Salmonella sp. 741265144_CST tRNA-Phe
  8547. Salmonella sp. 741265145_PSA tRNA-Phe
  8548. Salmonella sp. 741265146_PSA tRNA-Phe
  8549. Salmonella sp. A1301 tRNA-Phe
  8550. Salmonella sp. A1304 tRNA-Phe
  8551. Salmonella sp. A1307 tRNA-Phe
  8552. Salmonella sp. A1309 tRNA-Phe
  8553. Salmonella sp. A1311 tRNA-Phe
  8554. Salmonella sp. A1312 tRNA-Phe
  8555. Salmonella sp. A13131 tRNA-Phe
  8556. Salmonella sp. A13134 tRNA-Phe
  8557. Salmonella sp. A13135 tRNA-Phe
  8558. Salmonella sp. A13136 tRNA-Phe
  8559. Salmonella sp. A13139 tRNA-Phe
  8560. Salmonella sp. A13140 tRNA-Phe
  8561. Salmonella sp. A13141 tRNA-Phe
  8562. Salmonella sp. A13146 tRNA-Phe
  8563. Salmonella sp. A13147 tRNA-Phe
  8564. Salmonella sp. A13149 tRNA-Phe
  8565. Salmonella sp. A1314 tRNA-Phe
  8566. Salmonella sp. A13153 tRNA-Phe
  8567. Salmonella sp. A13154 tRNA-Phe
  8568. Salmonella sp. A13155 tRNA-Phe
  8569. Salmonella sp. A13156 tRNA-Phe
  8570. Salmonella sp. A13158 tRNA-Phe
  8571. Salmonella sp. A13159 tRNA-Phe
  8572. Salmonella sp. A1315 tRNA-Phe
  8573. Salmonella sp. A13165 tRNA-Phe
  8574. Salmonella sp. A13167 tRNA-Phe
  8575. Salmonella sp. A13169 tRNA-Phe
  8576. Salmonella sp. A1318 tRNA-Phe
  8577. Salmonella sp. A1321 tRNA-Phe
  8578. Salmonella sp. A1322 tRNA-Phe
  8579. Salmonella sp. A1324 tRNA-Phe
  8580. Salmonella sp. A13258 tRNA-Phe
  8581. Salmonella sp. A1325 tRNA-Phe
  8582. Salmonella sp. A13262 tRNA-Phe
  8583. Salmonella sp. A13266 tRNA-Phe
  8584. Salmonella sp. A13268 tRNA-Phe
  8585. Salmonella sp. A13269 tRNA-Phe
  8586. Salmonella sp. A1326 tRNA-Phe
  8587. Salmonella sp. A13270 tRNA-Phe
  8588. Salmonella sp. A13271 tRNA-Phe
  8589. Salmonella sp. A13274 tRNA-Phe
  8590. Salmonella sp. A13275 tRNA-Phe
  8591. Salmonella sp. A13278 tRNA-Phe
  8592. Salmonella sp. A1327 tRNA-Phe
  8593. Salmonella sp. A13280 tRNA-Phe
  8594. Salmonella sp. A13285 tRNA-Phe
  8595. Salmonella sp. A13287 tRNA-Phe
  8596. Salmonella sp. A13288 tRNA-Phe
  8597. Salmonella sp. A13289 tRNA-Phe
  8598. Salmonella sp. A13292 tRNA-Phe
  8599. Salmonella sp. A13303 tRNA-Phe
  8600. Salmonella sp. A13305 tRNA-Phe
  8601. Salmonella sp. A1331 tRNA-Phe
  8602. Salmonella sp. A1334 tRNA-Phe
  8603. Salmonella sp. A1335 tRNA-Phe
  8604. Salmonella sp. A1338 tRNA-Phe
  8605. Salmonella sp. A1339 tRNA-Phe
  8606. Salmonella sp. A1341 tRNA-Phe
  8607. Salmonella sp. A1343 tRNA-Phe
  8608. Salmonella sp. A1344 tRNA-Phe
  8609. Salmonella sp. A1346 tRNA-Phe
  8610. Salmonella sp. A1347 tRNA-Phe
  8611. Salmonella sp. A1350 tRNA-Phe
  8612. Salmonella sp. A1351 tRNA-Phe
  8613. Salmonella sp. A1356 tRNA-Phe
  8614. Salmonella sp. A1359 tRNA-Phe
  8615. Salmonella sp. A1360 tRNA-Phe
  8616. Salmonella sp. A1361 tRNA-Phe
  8617. Salmonella sp. A1365 tRNA-Phe
  8618. Salmonella sp. A1367 tRNA-Phe
  8619. Salmonella sp. A1369 tRNA-Phe
  8620. Salmonella sp. A1370 tRNA-Phe
  8621. Salmonella sp. A1371 tRNA-Phe
  8622. Salmonella sp. A1377 tRNA-Phe
  8623. Salmonella sp. A1378 tRNA-Phe
  8624. Salmonella sp. A1379 tRNA-Phe
  8625. Salmonella sp. A1382 tRNA-Phe
  8626. Salmonella sp. A1384 tRNA-Phe
  8627. Salmonella sp. A1385 tRNA-Phe
  8628. Salmonella sp. A1387 tRNA-Phe
  8629. Salmonella sp. A1388 tRNA-Phe
  8630. Salmonella sp. A1391 tRNA-Phe
  8631. Salmonella sp. A1392 tRNA-Phe
  8632. Salmonella sp. A1393 tRNA-Phe
  8633. Salmonella sp. A1394 tRNA-Phe
  8634. Salmonella sp. A1396 tRNA-Phe
  8635. Salmonella sp. A1397 tRNA-Phe
  8636. Salmonella sp. A1398 tRNA-Phe
  8637. Salmonella sp. A1442 tRNA-Phe
  8638. Salmonella sp. A1443 tRNA-Phe
  8639. Salmonella sp. A1444 tRNA-Phe
  8640. Salmonella sp. A1446 tRNA-Phe
  8641. Salmonella sp. A1450 tRNA-Phe
  8642. Salmonella sp. A1451 tRNA-Phe
  8643. Salmonella sp. A1452 tRNA-Phe
  8644. Salmonella sp. A1454 tRNA-Phe
  8645. Salmonella sp. A1455 tRNA-Phe
  8646. Salmonella sp. A1456 tRNA-Phe
  8647. Salmonella sp. A1457 tRNA-Phe
  8648. Salmonella sp. A1458 tRNA-Phe
  8649. Salmonella sp. A1459 tRNA-Phe
  8650. Salmonella sp. A1460 tRNA-Phe
  8651. Salmonella sp. A1463 tRNA-Phe
  8652. Salmonella sp. A1464 tRNA-Phe
  8653. Salmonella sp. A1465 tRNA-Phe
  8654. Salmonella sp. A1466 tRNA-Phe
  8655. Salmonella sp. A1467 tRNA-Phe
  8656. Salmonella sp. A1468 tRNA-Phe
  8657. Salmonella sp. A1470 tRNA-Phe
  8658. Salmonella sp. A1472 tRNA-Phe
  8659. Salmonella sp. A1473 tRNA-Phe
  8660. Salmonella sp. A1474 tRNA-Phe
  8661. Salmonella sp. A1475 tRNA-Phe
  8662. Salmonella sp. A1476 tRNA-Phe
  8663. Salmonella sp. A1477 tRNA-Phe
  8664. Salmonella sp. A1478 tRNA-Phe
  8665. Salmonella sp. A1480 tRNA-Phe
  8666. Salmonella sp. A1481 tRNA-Phe
  8667. Salmonella sp. A1482 tRNA-Phe
  8668. Salmonella sp. A1484 tRNA-Phe
  8669. Salmonella sp. A1485 tRNA-Phe
  8670. Salmonella sp. A1486 tRNA-Phe
  8671. Salmonella sp. A1488 tRNA-Phe
  8672. Salmonella sp. A1489 tRNA-Phe
  8673. Salmonella sp. A1490 tRNA-Phe
  8674. Salmonella sp. A1491 tRNA-Phe
  8675. Salmonella sp. A1492 tRNA-Phe
  8676. Salmonella sp. A1494 tRNA-Phe
  8677. Salmonella sp. A1496 tRNA-Phe
  8678. Salmonella sp. A1497 tRNA-Phe
  8679. Salmonella sp. A1500 tRNA-Phe
  8680. Salmonella sp. A1502 tRNA-Phe
  8681. Salmonella sp. A1503 tRNA-Phe
  8682. Salmonella sp. A1505 tRNA-Phe
  8683. Salmonella sp. A1506 tRNA-Phe
  8684. Salmonella sp. A1507 tRNA-Phe
  8685. Salmonella sp. A1508 tRNA-Phe
  8686. Salmonella sp. A1509 tRNA-Phe
  8687. Salmonella sp. A1510 tRNA-Phe
  8688. Salmonella sp. A1512 tRNA-Phe
  8689. Salmonella sp. A1515 tRNA-Phe
  8690. Salmonella sp. A1516 tRNA-Phe
  8691. Salmonella sp. A1517 tRNA-Phe
  8692. Salmonella sp. A1518 tRNA-Phe
  8693. Salmonella sp. A1519 tRNA-Phe
  8694. Salmonella sp. A1522 tRNA-Phe
  8695. Salmonella sp. A1523 tRNA-Phe
  8696. Salmonella sp. A1525 tRNA-Phe
  8697. Salmonella sp. A1526 tRNA-Phe
  8698. Salmonella sp. A1529 tRNA-Phe
  8699. Salmonella sp. A1530 tRNA-Phe
  8700. Salmonella sp. A1531 tRNA-Phe
  8701. Salmonella sp. A1532 tRNA-Phe
  8702. Salmonella sp. A1533 tRNA-Phe
  8703. Salmonella sp. A1534 tRNA-Phe
  8704. Salmonella sp. A1535 tRNA-Phe
  8705. Salmonella sp. A1536 tRNA-Phe
  8706. Salmonella sp. A1537 tRNA-Phe
  8707. Salmonella sp. A1539 tRNA-Phe
  8708. Salmonella sp. A1540 tRNA-Phe
  8709. Salmonella sp. A1541 tRNA-Phe
  8710. Salmonella sp. A1542 tRNA-Phe
  8711. Salmonella sp. A1543 tRNA-Phe
  8712. Salmonella sp. A1545 tRNA-Phe
  8713. Salmonella sp. A1546 tRNA-Phe
  8714. Salmonella sp. A1547 tRNA-Phe
  8715. Salmonella sp. A1548 tRNA-Phe
  8716. Salmonella sp. A1551 tRNA-Phe
  8717. Salmonella sp. A1552 tRNA-Phe
  8718. Salmonella sp. A1554 tRNA-Phe
  8719. Salmonella sp. A1556 tRNA-Phe
  8720. Salmonella sp. A1557 tRNA-Phe
  8721. Salmonella sp. A1621 tRNA-Phe
  8722. Salmonella sp. A1624 tRNA-Phe
  8723. Salmonella sp. A1630 tRNA-Phe
  8724. Salmonella sp. A1656 tRNA-Phe
  8725. Salmonella sp. A29-2 tRNA-Phe
  8726. Salmonella sp. A7 tRNA-Phe
  8727. Salmonella sp. B8 tRNA-Phe
  8728. Salmonella sp. BAS-1 tRNA-Phe
  8729. Salmonella sp. BAS-2 tRNA-Phe
  8730. Salmonella sp. BAS-3 tRNA-Phe
  8731. Salmonella sp. C1974 tRNA-Phe
  8732. Salmonella sp. C1982 tRNA-Phe
  8733. Salmonella sp. C2430 tRNA-Phe
  8734. Salmonella sp. C2474 tRNA-Phe
  8735. Salmonella sp. C2610 tRNA-Phe
  8736. Salmonella sp. C2719 tRNA-Phe
  8737. Salmonella sp. C2751 tRNA-Phe
  8738. Salmonella sp. C2907 tRNA-Phe
  8739. Salmonella sp. C2929 tRNA-Phe
  8740. Salmonella sp. C3002 tRNA-Phe
  8741. Salmonella sp. C3004 tRNA-Phe
  8742. Salmonella sp. C3006 tRNA-Phe
  8743. Salmonella sp. C3007 tRNA-Phe
  8744. Salmonella sp. C3008 tRNA-Phe
  8745. Salmonella sp. C3009 tRNA-Phe
  8746. Salmonella sp. C3010 tRNA-Phe
  8747. Salmonella sp. C3011 tRNA-Phe
  8748. Salmonella sp. C3012 tRNA-Phe
  8749. Salmonella sp. C3013 tRNA-Phe
  8750. Salmonella sp. C3014 tRNA-Phe
  8751. Salmonella sp. C3015 tRNA-Phe
  8752. Salmonella sp. C3016 tRNA-Phe
  8753. Salmonella sp. C3017 tRNA-Phe
  8754. Salmonella sp. C3018 tRNA-Phe
  8755. Salmonella sp. C3019 tRNA-Phe
  8756. Salmonella sp. C3020 tRNA-Phe
  8757. Salmonella sp. C3021 tRNA-Phe
  8758. Salmonella sp. C3022 tRNA-Phe
  8759. Salmonella sp. C3023 tRNA-Phe
  8760. Salmonella sp. C3024 tRNA-Phe
  8761. Salmonella sp. C3026 tRNA-Phe
  8762. Salmonella sp. C3029 tRNA-Phe
  8763. Salmonella sp. C3030 tRNA-Phe
  8764. Salmonella sp. C3034 tRNA-Phe
  8765. Salmonella sp. C3035 tRNA-Phe
  8766. Salmonella sp. C3037 tRNA-Phe
  8767. Salmonella sp. C3038 tRNA-Phe
  8768. Salmonella sp. C3039 tRNA-Phe
  8769. Salmonella sp. C3040 tRNA-Phe
  8770. Salmonella sp. C3041 tRNA-Phe
  8771. Salmonella sp. C3042 tRNA-Phe
  8772. Salmonella sp. C3043 tRNA-Phe
  8773. Salmonella sp. C3044 tRNA-Phe
  8774. Salmonella sp. C3045 tRNA-Phe
  8775. Salmonella sp. C3046 tRNA-Phe
  8776. Salmonella sp. C3047 tRNA-Phe
  8777. Salmonella sp. C3051 tRNA-Phe
  8778. Salmonella sp. C3052 tRNA-Phe
  8779. Salmonella sp. C3058 tRNA-Phe
  8780. Salmonella sp. C3060 tRNA-Phe
  8781. Salmonella sp. C3063 tRNA-Phe
  8782. Salmonella sp. C3064 tRNA-Phe
  8783. Salmonella sp. C3065 tRNA-Phe
  8784. Salmonella sp. C3067 tRNA-Phe
  8785. Salmonella sp. C3069 tRNA-Phe
  8786. Salmonella sp. C3071 tRNA-Phe
  8787. Salmonella sp. C3074 tRNA-Phe
  8788. Salmonella sp. C3076 tRNA-Phe
  8789. Salmonella sp. C3078 tRNA-Phe
  8790. Salmonella sp. C3080 tRNA-Phe
  8791. Salmonella sp. C3081 tRNA-Phe
  8792. Salmonella sp. C3082 tRNA-Phe
  8793. Salmonella sp. C3083 tRNA-Phe
  8794. Salmonella sp. C3085 tRNA-Phe
  8795. Salmonella sp. C3087 tRNA-Phe
  8796. Salmonella sp. C3089 tRNA-Phe
  8797. Salmonella sp. C3090 tRNA-Phe
  8798. Salmonella sp. C3092 tRNA-Phe
  8799. Salmonella sp. C3094 tRNA-Phe
  8800. Salmonella sp. C3095 tRNA-Phe
  8801. Salmonella sp. C3098 tRNA-Phe
  8802. Salmonella sp. C3100 tRNA-Phe
  8803. Salmonella sp. C3101 tRNA-Phe
  8804. Salmonella sp. C3103 tRNA-Phe
  8805. Salmonella sp. C3106 tRNA-Phe
  8806. Salmonella sp. C3107 tRNA-Phe
  8807. Salmonella sp. C3110 tRNA-Phe
  8808. Salmonella sp. C3112 tRNA-Phe
  8809. Salmonella sp. C3116 tRNA-Phe
  8810. Salmonella sp. C3117 tRNA-Phe
  8811. Salmonella sp. C3118 tRNA-Phe
  8812. Salmonella sp. C3121 tRNA-Phe
  8813. Salmonella sp. C3123 tRNA-Phe
  8814. Salmonella sp. C3125 tRNA-Phe
  8815. Salmonella sp. C3126 tRNA-Phe
  8816. Salmonella sp. C3132 tRNA-Phe
  8817. Salmonella sp. C3134 tRNA-Phe
  8818. Salmonella sp. C3136 tRNA-Phe
  8819. Salmonella sp. C3140 tRNA-Phe
  8820. Salmonella sp. C3143 tRNA-Phe
  8821. Salmonella sp. C3144 tRNA-Phe
  8822. Salmonella sp. C3145 tRNA-Phe
  8823. Salmonella sp. C3146 tRNA-Phe
  8824. Salmonella sp. C3147 tRNA-Phe
  8825. Salmonella sp. C3148 tRNA-Phe
  8826. Salmonella sp. C3149 tRNA-Phe
  8827. Salmonella sp. C3150 tRNA-Phe
  8828. Salmonella sp. C3151 tRNA-Phe
  8829. Salmonella sp. C3152 tRNA-Phe
  8830. Salmonella sp. C3153 tRNA-Phe
  8831. Salmonella sp. C3154 tRNA-Phe
  8832. Salmonella sp. C3155 tRNA-Phe
  8833. Salmonella sp. C3156 tRNA-Phe
  8834. Salmonella sp. C3157 tRNA-Phe
  8835. Salmonella sp. C3158 tRNA-Phe
  8836. Salmonella sp. C3159 tRNA-Phe
  8837. Salmonella sp. C3160 tRNA-Phe
  8838. Salmonella sp. C3161 tRNA-Phe
  8839. Salmonella sp. C3162 tRNA-Phe
  8840. Salmonella sp. C3163 tRNA-Phe
  8841. Salmonella sp. C3164 tRNA-Phe
  8842. Salmonella sp. C3165 tRNA-Phe
  8843. Salmonella sp. C3166 tRNA-Phe
  8844. Salmonella sp. C3168 tRNA-Phe
  8845. Salmonella sp. C3170 tRNA-Phe
  8846. Salmonella sp. C3171 tRNA-Phe
  8847. Salmonella sp. C3172 tRNA-Phe
  8848. Salmonella sp. C3173 tRNA-Phe
  8849. Salmonella sp. C3174 tRNA-Phe
  8850. Salmonella sp. C3175 tRNA-Phe
  8851. Salmonella sp. C3176 tRNA-Phe
  8852. Salmonella sp. C3177 tRNA-Phe
  8853. Salmonella sp. C3178 tRNA-Phe
  8854. Salmonella sp. C3179 tRNA-Phe
  8855. Salmonella sp. C3180 tRNA-Phe
  8856. Salmonella sp. C3181 tRNA-Phe
  8857. Salmonella sp. C3182 tRNA-Phe
  8858. Salmonella sp. C3183 tRNA-Phe
  8859. Salmonella sp. C3184 tRNA-Phe
  8860. Salmonella sp. C3185 tRNA-Phe
  8861. Salmonella sp. C3186 tRNA-Phe
  8862. Salmonella sp. C3187 tRNA-Phe
  8863. Salmonella sp. C3188 tRNA-Phe
  8864. Salmonella sp. C3189 tRNA-Phe
  8865. Salmonella sp. C3190 tRNA-Phe
  8866. Salmonella sp. C3191 tRNA-Phe
  8867. Salmonella sp. C3192 tRNA-Phe
  8868. Salmonella sp. C3193 tRNA-Phe
  8869. Salmonella sp. C3194 tRNA-Phe
  8870. Salmonella sp. C3195 tRNA-Phe
  8871. Salmonella sp. C3196 tRNA-Phe
  8872. Salmonella sp. C3197 tRNA-Phe
  8873. Salmonella sp. C3198 tRNA-Phe
  8874. Salmonella sp. C3199 tRNA-Phe
  8875. Salmonella sp. C3200 tRNA-Phe
  8876. Salmonella sp. C3201 tRNA-Phe
  8877. Salmonella sp. C3203 tRNA-Phe
  8878. Salmonella sp. C3204 tRNA-Phe
  8879. Salmonella sp. C3205 tRNA-Phe
  8880. Salmonella sp. C3206 tRNA-Phe
  8881. Salmonella sp. C3207 tRNA-Phe
  8882. Salmonella sp. C3208 tRNA-Phe
  8883. Salmonella sp. C3209 tRNA-Phe
  8884. Salmonella sp. C3210 tRNA-Phe
  8885. Salmonella sp. C3211 tRNA-Phe
  8886. Salmonella sp. C3212 tRNA-Phe
  8887. Salmonella sp. C3213 tRNA-Phe
  8888. Salmonella sp. C3214 tRNA-Phe
  8889. Salmonella sp. C3215 tRNA-Phe
  8890. Salmonella sp. C3216 tRNA-Phe
  8891. Salmonella sp. C3217 tRNA-Phe
  8892. Salmonella sp. C3218 tRNA-Phe
  8893. Salmonella sp. C3219 tRNA-Phe
  8894. Salmonella sp. C3220 tRNA-Phe
  8895. Salmonella sp. C3221 tRNA-Phe
  8896. Salmonella sp. C3222 tRNA-Phe
  8897. Salmonella sp. C3223 tRNA-Phe
  8898. Salmonella sp. C3224 tRNA-Phe
  8899. Salmonella sp. C3225 tRNA-Phe
  8900. Salmonella sp. C3226 tRNA-Phe
  8901. Salmonella sp. C3227 tRNA-Phe
  8902. Salmonella sp. C3228 tRNA-Phe
  8903. Salmonella sp. C3230 tRNA-Phe
  8904. Salmonella sp. C3231 tRNA-Phe
  8905. Salmonella sp. C3232 tRNA-Phe
  8906. Salmonella sp. C3233 tRNA-Phe
  8907. Salmonella sp. C3234 tRNA-Phe
  8908. Salmonella sp. C3235 tRNA-Phe
  8909. Salmonella sp. C3236 tRNA-Phe
  8910. Salmonella sp. C3237 tRNA-Phe
  8911. Salmonella sp. C3238 tRNA-Phe
  8912. Salmonella sp. C3239 tRNA-Phe
  8913. Salmonella sp. C3240 tRNA-Phe
  8914. Salmonella sp. C3241 tRNA-Phe
  8915. Salmonella sp. C3242 tRNA-Phe
  8916. Salmonella sp. C3243 tRNA-Phe
  8917. Salmonella sp. C3244 tRNA-Phe
  8918. Salmonella sp. C3245 tRNA-Phe
  8919. Salmonella sp. C3246 tRNA-Phe
  8920. Salmonella sp. C3247 tRNA-Phe
  8921. Salmonella sp. C3248 tRNA-Phe
  8922. Salmonella sp. C3249 tRNA-Phe
  8923. Salmonella sp. C3251 tRNA-Phe
  8924. Salmonella sp. C3252 tRNA-Phe
  8925. Salmonella sp. C3253 tRNA-Phe
  8926. Salmonella sp. C3254 tRNA-Phe
  8927. Salmonella sp. C3255 tRNA-Phe
  8928. Salmonella sp. C3256 tRNA-Phe
  8929. Salmonella sp. C3257 tRNA-Phe
  8930. Salmonella sp. C3258 tRNA-Phe
  8931. Salmonella sp. C3259 tRNA-Phe
  8932. Salmonella sp. C3260 tRNA-Phe
  8933. Salmonella sp. C3262 tRNA-Phe
  8934. Salmonella sp. C3263 tRNA-Phe
  8935. Salmonella sp. C3264 tRNA-Phe
  8936. Salmonella sp. C3265 tRNA-Phe
  8937. Salmonella sp. C3266 tRNA-Phe
  8938. Salmonella sp. C3267 tRNA-Phe
  8939. Salmonella sp. C3268 tRNA-Phe
  8940. Salmonella sp. C3269 tRNA-Phe
  8941. Salmonella sp. C3270 tRNA-Phe
  8942. Salmonella sp. C3271 tRNA-Phe
  8943. Salmonella sp. C3272 tRNA-Phe
  8944. Salmonella sp. C3273 tRNA-Phe
  8945. Salmonella sp. C3274 tRNA-Phe
  8946. Salmonella sp. C3275 tRNA-Phe
  8947. Salmonella sp. C3276 tRNA-Phe
  8948. Salmonella sp. C3277 tRNA-Phe
  8949. Salmonella sp. C3278 tRNA-Phe
  8950. Salmonella sp. C3279 tRNA-Phe
  8951. Salmonella sp. C3282 tRNA-Phe
  8952. Salmonella sp. C3283 tRNA-Phe
  8953. Salmonella sp. C3284 tRNA-Phe
  8954. Salmonella sp. C3285 tRNA-Phe
  8955. Salmonella sp. C3286 tRNA-Phe
  8956. Salmonella sp. C3287 tRNA-Phe
  8957. Salmonella sp. C3288 tRNA-Phe
  8958. Salmonella sp. C3290 tRNA-Phe
  8959. Salmonella sp. C3291 tRNA-Phe
  8960. Salmonella sp. C3292 tRNA-Phe
  8961. Salmonella sp. C3293 tRNA-Phe
  8962. Salmonella sp. C3294 tRNA-Phe
  8963. Salmonella sp. C3295 tRNA-Phe
  8964. Salmonella sp. C3297 tRNA-Phe
  8965. Salmonella sp. C3298 tRNA-Phe
  8966. Salmonella sp. C3299 tRNA-Phe
  8967. Salmonella sp. C3300 tRNA-Phe
  8968. Salmonella sp. C3301 tRNA-Phe
  8969. Salmonella sp. C3302 tRNA-Phe
  8970. Salmonella sp. C3303 tRNA-Phe
  8971. Salmonella sp. C3304 tRNA-Phe
  8972. Salmonella sp. C3305 tRNA-Phe
  8973. Salmonella sp. C3306 tRNA-Phe
  8974. Salmonella sp. C3307 tRNA-Phe
  8975. Salmonella sp. C3309 tRNA-Phe
  8976. Salmonella sp. C3312 tRNA-Phe
  8977. Salmonella sp. C3313 tRNA-Phe
  8978. Salmonella sp. C3314 tRNA-Phe
  8979. Salmonella sp. C3315 tRNA-Phe
  8980. Salmonella sp. C3316 tRNA-Phe
  8981. Salmonella sp. C3317 tRNA-Phe
  8982. Salmonella sp. C3318 tRNA-Phe
  8983. Salmonella sp. C3319 tRNA-Phe
  8984. Salmonella sp. C3321 tRNA-Phe
  8985. Salmonella sp. C3322 tRNA-Phe
  8986. Salmonella sp. C3323 tRNA-Phe
  8987. Salmonella sp. C3324 tRNA-Phe
  8988. Salmonella sp. C3325 tRNA-Phe
  8989. Salmonella sp. C3326 tRNA-Phe
  8990. Salmonella sp. C3327 tRNA-Phe
  8991. Salmonella sp. C3328 tRNA-Phe
  8992. Salmonella sp. C3329 tRNA-Phe
  8993. Salmonella sp. C3330 tRNA-Phe
  8994. Salmonella sp. C3331 tRNA-Phe
  8995. Salmonella sp. C3332 tRNA-Phe
  8996. Salmonella sp. C3333 tRNA-Phe
  8997. Salmonella sp. C3334 tRNA-Phe
  8998. Salmonella sp. C3335 tRNA-Phe
  8999. Salmonella sp. C3336 tRNA-Phe
  9000. Salmonella sp. C3338 tRNA-Phe
  9001. Salmonella sp. C3339 tRNA-Phe
  9002. Salmonella sp. C3340 tRNA-Phe
  9003. Salmonella sp. C3341 tRNA-Phe
  9004. Salmonella sp. C3342 tRNA-Phe
  9005. Salmonella sp. C3343 tRNA-Phe
  9006. Salmonella sp. CVCC 1806 tRNA-Phe
  9007. Salmonella sp. D5-9891 tRNA-Phe
  9008. Salmonella sp. fj-h1 tRNA-Phe
  9009. Salmonella sp. fjx14s14 tRNA-Phe
  9010. Salmonella sp. fjx14s17 tRNA-Phe
  9011. Salmonella sp. fjx14s1 tRNA-Phe
  9012. Salmonella sp. fjx14s7 tRNA-Phe
  9013. Salmonella sp. GDC200615 tRNA-Phe
  9014. Salmonella sp. gx-f4 tRNA-Phe
  9015. Salmonella sp. gx-f5 tRNA-Phe
  9016. Salmonella sp. gx-f7 tRNA-Phe
  9017. Salmonella sp. gx-f8 tRNA-Phe
  9018. Salmonella sp. gx-f9 tRNA-Phe
  9019. Salmonella sp. gx-h1 tRNA-Phe
  9020. Salmonella sp. H20-240 tRNA-Phe
  9021. Salmonella sp. H20-297 tRNA-Phe
  9022. Salmonella sp. H2-436 tRNA-Phe
  9023. Salmonella sp. HMSC13B08 tRNA-Phe
  9024. Salmonella sp. hn-f5 tRNA-Phe
  9025. Salmonella sp. hn-h2 tRNA-Phe
  9026. Salmonella sp. hn-h4 tRNA-Phe
  9027. Salmonella sp. HNK130 tRNA-Phe
  9028. Salmonella sp. HY31 tRNA-Phe
  9029. Salmonella sp. JS051105201500009SM tRNA-Phe
  9030. Salmonella sp. JXY0409-18 tRNA-Phe
  9031. Salmonella sp. K15193 tRNA-Phe
  9032. Salmonella sp. K17285 tRNA-Phe
  9033. Salmonella sp. K20285 tRNA-Phe
  9034. Salmonella sp. K21076 tRNA-Phe
  9035. Salmonella sp. K22279 tRNA-Phe
  9036. Salmonella sp. K24213 tRNA-Phe
  9037. Salmonella sp. K24256 tRNA-Phe
  9038. Salmonella sp. KL11283 tRNA-Phe
  9039. Salmonella sp. KL13372 tRNA-Phe
  9040. Salmonella sp. KL14053 tRNA-Phe
  9041. Salmonella sp. KL15030 tRNA-Phe
  9042. Salmonella sp. KL15157 tRNA-Phe
  9043. Salmonella sp. KL18108 tRNA-Phe
  9044. Salmonella sp. KL18194 tRNA-Phe
  9045. Salmonella sp. KL21070 tRNA-Phe
  9046. Salmonella sp. KL22014 tRNA-Phe
  9047. Salmonella sp. KL24021 tRNA-Phe
  9048. Salmonella sp. KL24049 tRNA-Phe
  9049. Salmonella sp. KL24102 tRNA-Phe
  9050. Salmonella sp. LPS 411/01 tRNA-Phe
  9051. Salmonella sp. LPS 503/02 tRNA-Phe
  9052. Salmonella sp. L-S1178 tRNA-Phe
  9053. Salmonella sp. L-S1409 tRNA-Phe
  9054. Salmonella sp. L-S1477 tRNA-Phe
  9055. Salmonella sp. L-S1857 tRNA-Phe
  9056. Salmonella sp. L-S2251 tRNA-Phe
  9057. Salmonella sp. L-S2353 tRNA-Phe
  9058. Salmonella sp. L-S2359 tRNA-Phe
  9059. Salmonella sp. L-S2402 tRNA-Phe
  9060. Salmonella sp. L-S2582 tRNA-Phe
  9061. Salmonella sp. L-S2618 tRNA-Phe
  9062. Salmonella sp. L-S2638 tRNA-Phe
  9063. Salmonella sp. L-S2806 tRNA-Phe
  9064. Salmonella sp. L-S2809 tRNA-Phe
  9065. Salmonella sp. L-S2816 tRNA-Phe
  9066. Salmonella sp. L-S2906 tRNA-Phe
  9067. Salmonella sp. L-S2921 tRNA-Phe
  9068. Salmonella sp. L-S2971 tRNA-Phe
  9069. Salmonella sp. L-S3099 tRNA-Phe
  9070. Salmonella sp. L-S3112 tRNA-Phe
  9071. Salmonella sp. L-S3606 tRNA-Phe
  9072. Salmonella sp. LSP 1142/03 tRNA-Phe
  9073. Salmonella sp. LSP 127/00 tRNA-Phe
  9074. Salmonella sp. LSP 127/12 tRNA-Phe
  9075. Salmonella sp. LSP 148/00 tRNA-Phe
  9076. Salmonella sp. LSP 148/18 tRNA-Phe
  9077. Salmonella sp. LSP 151/00 tRNA-Phe
  9078. Salmonella sp. LSP 195/13 tRNA-Phe
  9079. Salmonella sp. LSP 196/10 tRNA-Phe
  9080. Salmonella sp. LSP 207/08 tRNA-Phe
  9081. Salmonella sp. LSP 21/00 tRNA-Phe
  9082. Salmonella sp. LSP 2/15 tRNA-Phe
  9083. Salmonella sp. LSP 245/13 tRNA-Phe
  9084. Salmonella sp. LSP 247/00 tRNA-Phe
  9085. Salmonella sp. LSP 259/13 tRNA-Phe
  9086. Salmonella sp. LSP 262/02 tRNA-Phe
  9087. Salmonella sp. LSP 272/98 tRNA-Phe
  9088. Salmonella sp. LSP 3/02 tRNA-Phe
  9089. Salmonella sp. LSP 304/17 tRNA-Phe
  9090. Salmonella sp. LSP 37/00 tRNA-Phe
  9091. Salmonella sp. LSP 40/00 tRNA-Phe
  9092. Salmonella sp. LSP 41/01 tRNA-Phe
  9093. Salmonella sp. LSP 417/00 tRNA-Phe
  9094. Salmonella sp. LSP 438/15 tRNA-Phe
  9095. Salmonella sp. LSP 474/14 tRNA-Phe
  9096. Salmonella sp. LSP 48/12 tRNA-Phe
  9097. Salmonella sp. LSP 54/18 tRNA-Phe
  9098. Salmonella sp. LSP 576/01 tRNA-Phe
  9099. Salmonella sp. LSP 578/01 tRNA-Phe
  9100. Salmonella sp. LSP 61/13 tRNA-Phe
  9101. Salmonella sp. LSP 62/12 tRNA-Phe
  9102. Salmonella sp. LSP 66/01 tRNA-Phe
  9103. Salmonella sp. LSP 718/02 tRNA-Phe
  9104. Salmonella sp. LSP 73/01 tRNA-Phe
  9105. Salmonella sp. LSP 80/01 tRNA-Phe
  9106. Salmonella sp. LSP 84/01 tRNA-Phe
  9107. Salmonella sp. LSP 87/13 tRNA-Phe
  9108. Salmonella sp. MS301 tRNA-Phe
  9109. Salmonella sp. NCTC 11881 tRNA-Phe(gaa)
  9110. Salmonella sp. NCTC 7297 tRNA-Phe(gaa)
  9111. Salmonella sp. NW1000 tRNA-Phe
  9112. Salmonella sp. NW1004 tRNA-Phe
  9113. Salmonella sp. NW1005 tRNA-Phe
  9114. Salmonella sp. NW1007 tRNA-Phe
  9115. Salmonella sp. NW1008 tRNA-Phe
  9116. Salmonella sp. NW1009 tRNA-Phe
  9117. Salmonella sp. NW100 tRNA-Phe
  9118. Salmonella sp. NW1010 tRNA-Phe
  9119. Salmonella sp. NW1011 tRNA-Phe
  9120. Salmonella sp. NW1013 tRNA-Phe
  9121. Salmonella sp. NW1014 tRNA-Phe
  9122. Salmonella sp. NW1015 tRNA-Phe
  9123. Salmonella sp. NW1016 tRNA-Phe
  9124. Salmonella sp. NW1017 tRNA-Phe
  9125. Salmonella sp. NW1018 tRNA-Phe
  9126. Salmonella sp. NW101 tRNA-Phe
  9127. Salmonella sp. NW1020 tRNA-Phe
  9128. Salmonella sp. NW1022 tRNA-Phe
  9129. Salmonella sp. NW1023 tRNA-Phe
  9130. Salmonella sp. NW1024 tRNA-Phe
  9131. Salmonella sp. NW1025 tRNA-Phe
  9132. Salmonella sp. NW1026 tRNA-Phe
  9133. Salmonella sp. NW1027 tRNA-Phe
  9134. Salmonella sp. NW1028 tRNA-Phe
  9135. Salmonella sp. NW1029 tRNA-Phe
  9136. Salmonella sp. NW102 tRNA-Phe
  9137. Salmonella sp. NW1030 tRNA-Phe
  9138. Salmonella sp. NW1031 tRNA-Phe
  9139. Salmonella sp. NW1033 tRNA-Phe
  9140. Salmonella sp. NW103 tRNA-Phe
  9141. Salmonella sp. NW1041 tRNA-Phe
  9142. Salmonella sp. NW1043 tRNA-Phe
  9143. Salmonella sp. NW1045 tRNA-Phe
  9144. Salmonella sp. NW1046 tRNA-Phe
  9145. Salmonella sp. NW1047 tRNA-Phe
  9146. Salmonella sp. NW1048 tRNA-Phe
  9147. Salmonella sp. NW1049 tRNA-Phe
  9148. Salmonella sp. NW104 tRNA-Phe
  9149. Salmonella sp. NW1050 tRNA-Phe
  9150. Salmonella sp. NW1052 tRNA-Phe
  9151. Salmonella sp. NW1053 tRNA-Phe
  9152. Salmonella sp. NW1055 tRNA-Phe
  9153. Salmonella sp. NW1057 tRNA-Phe
  9154. Salmonella sp. NW1058 tRNA-Phe
  9155. Salmonella sp. NW1059 tRNA-Phe
  9156. Salmonella sp. NW105 tRNA-Phe
  9157. Salmonella sp. NW1061 tRNA-Phe
  9158. Salmonella sp. NW1062 tRNA-Phe
  9159. Salmonella sp. NW1064 tRNA-Phe
  9160. Salmonella sp. NW1065 tRNA-Phe
  9161. Salmonella sp. NW1066 tRNA-Phe
  9162. Salmonella sp. NW1067 tRNA-Phe
  9163. Salmonella sp. NW1068 tRNA-Phe
  9164. Salmonella sp. NW1069 tRNA-Phe
  9165. Salmonella sp. NW106 tRNA-Phe
  9166. Salmonella sp. NW1071 tRNA-Phe
  9167. Salmonella sp. NW1072 tRNA-Phe
  9168. Salmonella sp. NW1073 tRNA-Phe
  9169. Salmonella sp. NW1074 tRNA-Phe
  9170. Salmonella sp. NW1077 tRNA-Phe
  9171. Salmonella sp. NW1078 tRNA-Phe
  9172. Salmonella sp. NW1079 tRNA-Phe
  9173. Salmonella sp. NW107 tRNA-Phe
  9174. Salmonella sp. NW1080 tRNA-Phe
  9175. Salmonella sp. NW1084 tRNA-Phe
  9176. Salmonella sp. NW1085 tRNA-Phe
  9177. Salmonella sp. NW1086 tRNA-Phe
  9178. Salmonella sp. NW1088 tRNA-Phe
  9179. Salmonella sp. NW1089 tRNA-Phe
  9180. Salmonella sp. NW108 tRNA-Phe
  9181. Salmonella sp. NW1090 tRNA-Phe
  9182. Salmonella sp. NW1092 tRNA-Phe
  9183. Salmonella sp. NW1094 tRNA-Phe
  9184. Salmonella sp. NW1095 tRNA-Phe
  9185. Salmonella sp. NW1096 tRNA-Phe
  9186. Salmonella sp. NW1098 tRNA-Phe
  9187. Salmonella sp. NW1099 tRNA-Phe
  9188. Salmonella sp. NW109 tRNA-Phe
  9189. Salmonella sp. NW10 tRNA-Phe
  9190. Salmonella sp. NW1100 tRNA-Phe
  9191. Salmonella sp. NW1102 tRNA-Phe
  9192. Salmonella sp. NW1103 tRNA-Phe
  9193. Salmonella sp. NW1105 tRNA-Phe
  9194. Salmonella sp. NW1107 tRNA-Phe
  9195. Salmonella sp. NW1108 tRNA-Phe
  9196. Salmonella sp. NW1109 tRNA-Phe
  9197. Salmonella sp. NW110 tRNA-Phe
  9198. Salmonella sp. NW1110 tRNA-Phe
  9199. Salmonella sp. NW1111 tRNA-Phe
  9200. Salmonella sp. NW1113 tRNA-Phe
  9201. Salmonella sp. NW1114 tRNA-Phe
  9202. Salmonella sp. NW1115 tRNA-Phe
  9203. Salmonella sp. NW1121 tRNA-Phe
  9204. Salmonella sp. NW1122 tRNA-Phe
  9205. Salmonella sp. NW1124 tRNA-Phe
  9206. Salmonella sp. NW1126 tRNA-Phe
  9207. Salmonella sp. NW1128 tRNA-Phe
  9208. Salmonella sp. NW1131 tRNA-Phe
  9209. Salmonella sp. NW1132 tRNA-Phe
  9210. Salmonella sp. NW1134 tRNA-Phe
  9211. Salmonella sp. NW1135 tRNA-Phe
  9212. Salmonella sp. NW1140 tRNA-Phe
  9213. Salmonella sp. NW1141 tRNA-Phe
  9214. Salmonella sp. NW1142 tRNA-Phe
  9215. Salmonella sp. NW1143 tRNA-Phe
  9216. Salmonella sp. NW1146 tRNA-Phe
  9217. Salmonella sp. NW1147 tRNA-Phe
  9218. Salmonella sp. NW1148 tRNA-Phe
  9219. Salmonella sp. NW1149 tRNA-Phe
  9220. Salmonella sp. NW1151 tRNA-Phe
  9221. Salmonella sp. NW1152 tRNA-Phe
  9222. Salmonella sp. NW1153 tRNA-Phe
  9223. Salmonella sp. NW1157 tRNA-Phe
  9224. Salmonella sp. NW1159 tRNA-Phe
  9225. Salmonella sp. NW1160 tRNA-Phe
  9226. Salmonella sp. NW1163 tRNA-Phe
  9227. Salmonella sp. NW1165 tRNA-Phe
  9228. Salmonella sp. NW1166 tRNA-Phe
  9229. Salmonella sp. NW1167 tRNA-Phe
  9230. Salmonella sp. NW1169 tRNA-Phe
  9231. Salmonella sp. NW116 tRNA-Phe
  9232. Salmonella sp. NW1172 tRNA-Phe
  9233. Salmonella sp. NW1173 tRNA-Phe
  9234. Salmonella sp. NW1174 tRNA-Phe
  9235. Salmonella sp. NW1176 tRNA-Phe
  9236. Salmonella sp. NW1177 tRNA-Phe
  9237. Salmonella sp. NW1178 tRNA-Phe
  9238. Salmonella sp. NW1180 tRNA-Phe
  9239. Salmonella sp. NW1181 tRNA-Phe
  9240. Salmonella sp. NW1183 tRNA-Phe
  9241. Salmonella sp. NW1184 tRNA-Phe
  9242. Salmonella sp. NW1186 tRNA-Phe
  9243. Salmonella sp. NW1187 tRNA-Phe
  9244. Salmonella sp. NW1188 tRNA-Phe
  9245. Salmonella sp. NW1189 tRNA-Phe
  9246. Salmonella sp. NW118 tRNA-Phe
  9247. Salmonella sp. NW1190 tRNA-Phe
  9248. Salmonella sp. NW1191 tRNA-Phe
  9249. Salmonella sp. NW1192 tRNA-Phe
  9250. Salmonella sp. NW1193 tRNA-Phe
  9251. Salmonella sp. NW1194 tRNA-Phe
  9252. Salmonella sp. NW1196 tRNA-Phe
  9253. Salmonella sp. NW1197 tRNA-Phe
  9254. Salmonella sp. NW1198 tRNA-Phe
  9255. Salmonella sp. NW1199 tRNA-Phe
  9256. Salmonella sp. NW11 tRNA-Phe
  9257. Salmonella sp. NW1200 tRNA-Phe
  9258. Salmonella sp. NW1202 tRNA-Phe
  9259. Salmonella sp. NW1203 tRNA-Phe
  9260. Salmonella sp. NW1205 tRNA-Phe
  9261. Salmonella sp. NW1206 tRNA-Phe
  9262. Salmonella sp. NW1207 tRNA-Phe
  9263. Salmonella sp. NW1209 tRNA-Phe
  9264. Salmonella sp. NW120 tRNA-Phe
  9265. Salmonella sp. NW1210 tRNA-Phe
  9266. Salmonella sp. NW1213 tRNA-Phe
  9267. Salmonella sp. NW1214 tRNA-Phe
  9268. Salmonella sp. NW1215 tRNA-Phe
  9269. Salmonella sp. NW1216 tRNA-Phe
  9270. Salmonella sp. NW1217 tRNA-Phe
  9271. Salmonella sp. NW1219 tRNA-Phe
  9272. Salmonella sp. NW1222 tRNA-Phe
  9273. Salmonella sp. NW122 tRNA-Phe
  9274. Salmonella sp. NW1231 tRNA-Phe
  9275. Salmonella sp. NW1232 tRNA-Phe
  9276. Salmonella sp. NW1233 tRNA-Phe
  9277. Salmonella sp. NW1234 tRNA-Phe
  9278. Salmonella sp. NW1235 tRNA-Phe
  9279. Salmonella sp. NW1236 tRNA-Phe
  9280. Salmonella sp. NW1237 tRNA-Phe
  9281. Salmonella sp. NW1238 tRNA-Phe
  9282. Salmonella sp. NW1239 tRNA-Phe
  9283. Salmonella sp. NW1240 tRNA-Phe
  9284. Salmonella sp. NW1241 tRNA-Phe
  9285. Salmonella sp. NW1242 tRNA-Phe
  9286. Salmonella sp. NW1243 tRNA-Phe
  9287. Salmonella sp. NW1244 tRNA-Phe
  9288. Salmonella sp. NW1245 tRNA-Phe
  9289. Salmonella sp. NW1246 tRNA-Phe
  9290. Salmonella sp. NW1247 tRNA-Phe
  9291. Salmonella sp. NW1248 tRNA-Phe
  9292. Salmonella sp. NW1249 tRNA-Phe
  9293. Salmonella sp. NW124 tRNA-Phe
  9294. Salmonella sp. NW1250 tRNA-Phe
  9295. Salmonella sp. NW1251 tRNA-Phe
  9296. Salmonella sp. NW1252 tRNA-Phe
  9297. Salmonella sp. NW1253 tRNA-Phe
  9298. Salmonella sp. NW1254 tRNA-Phe
  9299. Salmonella sp. NW1255 tRNA-Phe
  9300. Salmonella sp. NW1256 tRNA-Phe
  9301. Salmonella sp. NW1257 tRNA-Phe
  9302. Salmonella sp. NW1258 tRNA-Phe
  9303. Salmonella sp. NW1259 tRNA-Phe
  9304. Salmonella sp. NW125 tRNA-Phe
  9305. Salmonella sp. NW1260 tRNA-Phe
  9306. Salmonella sp. NW1261 tRNA-Phe
  9307. Salmonella sp. NW1262 tRNA-Phe
  9308. Salmonella sp. NW1263 tRNA-Phe
  9309. Salmonella sp. NW1264 tRNA-Phe
  9310. Salmonella sp. NW1267 tRNA-Phe
  9311. Salmonella sp. NW1268 tRNA-Phe
  9312. Salmonella sp. NW1269 tRNA-Phe
  9313. Salmonella sp. NW126 tRNA-Phe
  9314. Salmonella sp. NW1270 tRNA-Phe
  9315. Salmonella sp. NW1271 tRNA-Phe
  9316. Salmonella sp. NW1273 tRNA-Phe
  9317. Salmonella sp. NW1274 tRNA-Phe
  9318. Salmonella sp. NW1275 tRNA-Phe
  9319. Salmonella sp. NW1276 tRNA-Phe
  9320. Salmonella sp. NW1277 tRNA-Phe
  9321. Salmonella sp. NW1278 tRNA-Phe
  9322. Salmonella sp. NW1279 tRNA-Phe
  9323. Salmonella sp. NW127 tRNA-Phe
  9324. Salmonella sp. NW1280 tRNA-Phe
  9325. Salmonella sp. NW1281 tRNA-Phe
  9326. Salmonella sp. NW1282 tRNA-Phe
  9327. Salmonella sp. NW1283 tRNA-Phe
  9328. Salmonella sp. NW1284 tRNA-Phe
  9329. Salmonella sp. NW1285 tRNA-Phe
  9330. Salmonella sp. NW128 tRNA-Phe
  9331. Salmonella sp. NW129 tRNA-Phe
  9332. Salmonella sp. NW12 tRNA-Phe
  9333. Salmonella sp. NW130 tRNA-Phe
  9334. Salmonella sp. NW131 tRNA-Phe
  9335. Salmonella sp. NW132 tRNA-Phe
  9336. Salmonella sp. NW133 tRNA-Phe
  9337. Salmonella sp. NW134 tRNA-Phe
  9338. Salmonella sp. NW135 tRNA-Phe
  9339. Salmonella sp. NW136 tRNA-Phe
  9340. Salmonella sp. NW137 tRNA-Phe
  9341. Salmonella sp. NW138 tRNA-Phe
  9342. Salmonella sp. NW139 tRNA-Phe
  9343. Salmonella sp. NW13 tRNA-Phe
  9344. Salmonella sp. NW140 tRNA-Phe
  9345. Salmonella sp. NW141 tRNA-Phe
  9346. Salmonella sp. NW142 tRNA-Phe
  9347. Salmonella sp. NW143 tRNA-Phe
  9348. Salmonella sp. NW144 tRNA-Phe
  9349. Salmonella sp. NW145 tRNA-Phe
  9350. Salmonella sp. NW146 tRNA-Phe
  9351. Salmonella sp. NW147 tRNA-Phe
  9352. Salmonella sp. NW148 tRNA-Phe
  9353. Salmonella sp. NW149 tRNA-Phe
  9354. Salmonella sp. NW14 tRNA-Phe
  9355. Salmonella sp. NW150 tRNA-Phe
  9356. Salmonella sp. NW151 tRNA-Phe
  9357. Salmonella sp. NW152 tRNA-Phe
  9358. Salmonella sp. NW153 tRNA-Phe
  9359. Salmonella sp. NW154 tRNA-Phe
  9360. Salmonella sp. NW155 tRNA-Phe
  9361. Salmonella sp. NW156 tRNA-Phe
  9362. Salmonella sp. NW157 tRNA-Phe
  9363. Salmonella sp. NW158 tRNA-Phe
  9364. Salmonella sp. NW159 tRNA-Phe
  9365. Salmonella sp. NW15 tRNA-Phe
  9366. Salmonella sp. NW160 tRNA-Phe
  9367. Salmonella sp. NW161 tRNA-Phe
  9368. Salmonella sp. NW162 tRNA-Phe
  9369. Salmonella sp. NW163 tRNA-Phe
  9370. Salmonella sp. NW164 tRNA-Phe
  9371. Salmonella sp. NW165 tRNA-Phe
  9372. Salmonella sp. NW166 tRNA-Phe
  9373. Salmonella sp. NW167 tRNA-Phe
  9374. Salmonella sp. NW168 tRNA-Phe
  9375. Salmonella sp. NW169 tRNA-Phe
  9376. Salmonella sp. NW16 tRNA-Phe
  9377. Salmonella sp. NW170 tRNA-Phe
  9378. Salmonella sp. NW171 tRNA-Phe
  9379. Salmonella sp. NW172 tRNA-Phe
  9380. Salmonella sp. NW173 tRNA-Phe
  9381. Salmonella sp. NW174 tRNA-Phe
  9382. Salmonella sp. NW176 tRNA-Phe
  9383. Salmonella sp. NW177 tRNA-Phe
  9384. Salmonella sp. NW178 tRNA-Phe
  9385. Salmonella sp. NW179 tRNA-Phe
  9386. Salmonella sp. NW17 tRNA-Phe
  9387. Salmonella sp. NW180 tRNA-Phe
  9388. Salmonella sp. NW181 tRNA-Phe
  9389. Salmonella sp. NW182 tRNA-Phe
  9390. Salmonella sp. NW183 tRNA-Phe
  9391. Salmonella sp. NW184 tRNA-Phe
  9392. Salmonella sp. NW185 tRNA-Phe
  9393. Salmonella sp. NW186 tRNA-Phe
  9394. Salmonella sp. NW187 tRNA-Phe
  9395. Salmonella sp. NW188 tRNA-Phe
  9396. Salmonella sp. NW189 tRNA-Phe
  9397. Salmonella sp. NW18 tRNA-Phe
  9398. Salmonella sp. NW190 tRNA-Phe
  9399. Salmonella sp. NW191 tRNA-Phe
  9400. Salmonella sp. NW192 tRNA-Phe
  9401. Salmonella sp. NW193 tRNA-Phe
  9402. Salmonella sp. NW194 tRNA-Phe
  9403. Salmonella sp. NW195 tRNA-Phe
  9404. Salmonella sp. NW196 tRNA-Phe
  9405. Salmonella sp. NW198 tRNA-Phe
  9406. Salmonella sp. NW19 tRNA-Phe
  9407. Salmonella sp. NW1 tRNA-Phe
  9408. Salmonella sp. NW200 tRNA-Phe
  9409. Salmonella sp. NW201 tRNA-Phe
  9410. Salmonella sp. NW202 tRNA-Phe
  9411. Salmonella sp. NW203 tRNA-Phe
  9412. Salmonella sp. NW205 tRNA-Phe
  9413. Salmonella sp. NW207 tRNA-Phe
  9414. Salmonella sp. NW208 tRNA-Phe
  9415. Salmonella sp. NW20 tRNA-Phe
  9416. Salmonella sp. NW210 tRNA-Phe
  9417. Salmonella sp. NW211 tRNA-Phe
  9418. Salmonella sp. NW213 tRNA-Phe
  9419. Salmonella sp. NW216 tRNA-Phe
  9420. Salmonella sp. NW217 tRNA-Phe
  9421. Salmonella sp. NW219 tRNA-Phe
  9422. Salmonella sp. NW21 tRNA-Phe
  9423. Salmonella sp. NW220 tRNA-Phe
  9424. Salmonella sp. NW221 tRNA-Phe
  9425. Salmonella sp. NW222 tRNA-Phe
  9426. Salmonella sp. NW223 tRNA-Phe
  9427. Salmonella sp. NW225 tRNA-Phe
  9428. Salmonella sp. NW226 tRNA-Phe
  9429. Salmonella sp. NW227 tRNA-Phe
  9430. Salmonella sp. NW229 tRNA-Phe
  9431. Salmonella sp. NW22 tRNA-Phe
  9432. Salmonella sp. NW230 tRNA-Phe
  9433. Salmonella sp. NW231 tRNA-Phe
  9434. Salmonella sp. NW232 tRNA-Phe
  9435. Salmonella sp. NW234 tRNA-Phe
  9436. Salmonella sp. NW235 tRNA-Phe
  9437. Salmonella sp. NW236 tRNA-Phe
  9438. Salmonella sp. NW238 tRNA-Phe
  9439. Salmonella sp. NW23 tRNA-Phe
  9440. Salmonella sp. NW240 tRNA-Phe
  9441. Salmonella sp. NW241 tRNA-Phe
  9442. Salmonella sp. NW242 tRNA-Phe
  9443. Salmonella sp. NW243 tRNA-Phe
  9444. Salmonella sp. NW244 tRNA-Phe
  9445. Salmonella sp. NW245 tRNA-Phe
  9446. Salmonella sp. NW246 tRNA-Phe
  9447. Salmonella sp. NW247 tRNA-Phe
  9448. Salmonella sp. NW248 tRNA-Phe
  9449. Salmonella sp. NW249 tRNA-Phe
  9450. Salmonella sp. NW24 tRNA-Phe
  9451. Salmonella sp. NW251 tRNA-Phe
  9452. Salmonella sp. NW252 tRNA-Phe
  9453. Salmonella sp. NW253 tRNA-Phe
  9454. Salmonella sp. NW254 tRNA-Phe
  9455. Salmonella sp. NW256 tRNA-Phe
  9456. Salmonella sp. NW25 tRNA-Phe
  9457. Salmonella sp. NW260 tRNA-Phe
  9458. Salmonella sp. NW261 tRNA-Phe
  9459. Salmonella sp. NW262 tRNA-Phe
  9460. Salmonella sp. NW263 tRNA-Phe
  9461. Salmonella sp. NW264 tRNA-Phe
  9462. Salmonella sp. NW268 tRNA-Phe
  9463. Salmonella sp. NW269 tRNA-Phe
  9464. Salmonella sp. NW270 tRNA-Phe
  9465. Salmonella sp. NW271 tRNA-Phe
  9466. Salmonella sp. NW272 tRNA-Phe
  9467. Salmonella sp. NW273 tRNA-Phe
  9468. Salmonella sp. NW274 tRNA-Phe
  9469. Salmonella sp. NW276 tRNA-Phe
  9470. Salmonella sp. NW277 tRNA-Phe
  9471. Salmonella sp. NW279 tRNA-Phe
  9472. Salmonella sp. NW27 tRNA-Phe
  9473. Salmonella sp. NW280 tRNA-Phe
  9474. Salmonella sp. NW283 tRNA-Phe
  9475. Salmonella sp. NW285 tRNA-Phe
  9476. Salmonella sp. NW286 tRNA-Phe
  9477. Salmonella sp. NW287 tRNA-Phe
  9478. Salmonella sp. NW288 tRNA-Phe
  9479. Salmonella sp. NW289 tRNA-Phe
  9480. Salmonella sp. NW28 tRNA-Phe
  9481. Salmonella sp. NW290 tRNA-Phe
  9482. Salmonella sp. NW293 tRNA-Phe
  9483. Salmonella sp. NW294 tRNA-Phe
  9484. Salmonella sp. NW295 tRNA-Phe
  9485. Salmonella sp. NW297 tRNA-Phe
  9486. Salmonella sp. NW298 tRNA-Phe
  9487. Salmonella sp. NW299 tRNA-Phe
  9488. Salmonella sp. NW29 tRNA-Phe
  9489. Salmonella sp. NW2 tRNA-Phe
  9490. Salmonella sp. NW301 tRNA-Phe
  9491. Salmonella sp. NW302 tRNA-Phe
  9492. Salmonella sp. NW303 tRNA-Phe
  9493. Salmonella sp. NW304 tRNA-Phe
  9494. Salmonella sp. NW305 tRNA-Phe
  9495. Salmonella sp. NW307 tRNA-Phe
  9496. Salmonella sp. NW309 tRNA-Phe
  9497. Salmonella sp. NW310 tRNA-Phe
  9498. Salmonella sp. NW311 tRNA-Phe
  9499. Salmonella sp. NW312 tRNA-Phe
  9500. Salmonella sp. NW315 tRNA-Phe
  9501. Salmonella sp. NW316 tRNA-Phe
  9502. Salmonella sp. NW317 tRNA-Phe
  9503. Salmonella sp. NW318 tRNA-Phe
  9504. Salmonella sp. NW319 tRNA-Phe
  9505. Salmonella sp. NW31 tRNA-Phe
  9506. Salmonella sp. NW320 tRNA-Phe
  9507. Salmonella sp. NW321 tRNA-Phe
  9508. Salmonella sp. NW322 tRNA-Phe
  9509. Salmonella sp. NW323 tRNA-Phe
  9510. Salmonella sp. NW324 tRNA-Phe
  9511. Salmonella sp. NW325 tRNA-Phe
  9512. Salmonella sp. NW326 tRNA-Phe
  9513. Salmonella sp. NW328 tRNA-Phe
  9514. Salmonella sp. NW329 tRNA-Phe
  9515. Salmonella sp. NW32 tRNA-Phe
  9516. Salmonella sp. NW331 tRNA-Phe
  9517. Salmonella sp. NW333 tRNA-Phe
  9518. Salmonella sp. NW335 tRNA-Phe
  9519. Salmonella sp. NW337 tRNA-Phe
  9520. Salmonella sp. NW338 tRNA-Phe
  9521. Salmonella sp. NW33 tRNA-Phe
  9522. Salmonella sp. NW341 tRNA-Phe
  9523. Salmonella sp. NW342 tRNA-Phe
  9524. Salmonella sp. NW343 tRNA-Phe
  9525. Salmonella sp. NW350 tRNA-Phe
  9526. Salmonella sp. NW352 tRNA-Phe
  9527. Salmonella sp. NW353 tRNA-Phe
  9528. Salmonella sp. NW354 tRNA-Phe
  9529. Salmonella sp. NW355 tRNA-Phe
  9530. Salmonella sp. NW356 tRNA-Phe
  9531. Salmonella sp. NW357 tRNA-Phe
  9532. Salmonella sp. NW358 tRNA-Phe
  9533. Salmonella sp. NW35 tRNA-Phe
  9534. Salmonella sp. NW360 tRNA-Phe
  9535. Salmonella sp. NW363 tRNA-Phe
  9536. Salmonella sp. NW364 tRNA-Phe
  9537. Salmonella sp. NW366 tRNA-Phe
  9538. Salmonella sp. NW367 tRNA-Phe
  9539. Salmonella sp. NW368 tRNA-Phe
  9540. Salmonella sp. NW369 tRNA-Phe
  9541. Salmonella sp. NW36 tRNA-Phe
  9542. Salmonella sp. NW370 tRNA-Phe
  9543. Salmonella sp. NW372 tRNA-Phe
  9544. Salmonella sp. NW373 tRNA-Phe
  9545. Salmonella sp. NW375 tRNA-Phe
  9546. Salmonella sp. NW377 tRNA-Phe
  9547. Salmonella sp. NW378 tRNA-Phe
  9548. Salmonella sp. NW379 tRNA-Phe
  9549. Salmonella sp. NW37 tRNA-Phe
  9550. Salmonella sp. NW380 tRNA-Phe
  9551. Salmonella sp. NW381 tRNA-Phe
  9552. Salmonella sp. NW382 tRNA-Phe
  9553. Salmonella sp. NW383 tRNA-Phe
  9554. Salmonella sp. NW384 tRNA-Phe
  9555. Salmonella sp. NW386 tRNA-Phe
  9556. Salmonella sp. NW387 tRNA-Phe
  9557. Salmonella sp. NW38 tRNA-Phe
  9558. Salmonella sp. NW390 tRNA-Phe
  9559. Salmonella sp. NW392 tRNA-Phe
  9560. Salmonella sp. NW394 tRNA-Phe
  9561. Salmonella sp. NW395 tRNA-Phe
  9562. Salmonella sp. NW396 tRNA-Phe
  9563. Salmonella sp. NW397 tRNA-Phe
  9564. Salmonella sp. NW398 tRNA-Phe
  9565. Salmonella sp. NW399 tRNA-Phe
  9566. Salmonella sp. NW39 tRNA-Phe
  9567. Salmonella sp. NW3 tRNA-Phe
  9568. Salmonella sp. NW401 tRNA-Phe
  9569. Salmonella sp. NW402 tRNA-Phe
  9570. Salmonella sp. NW403 tRNA-Phe
  9571. Salmonella sp. NW404 tRNA-Phe
  9572. Salmonella sp. NW406 tRNA-Phe
  9573. Salmonella sp. NW407 tRNA-Phe
  9574. Salmonella sp. NW408 tRNA-Phe
  9575. Salmonella sp. NW409 tRNA-Phe
  9576. Salmonella sp. NW40 tRNA-Phe
  9577. Salmonella sp. NW410 tRNA-Phe
  9578. Salmonella sp. NW411 tRNA-Phe
  9579. Salmonella sp. NW412 tRNA-Phe
  9580. Salmonella sp. NW413 tRNA-Phe
  9581. Salmonella sp. NW414 tRNA-Phe
  9582. Salmonella sp. NW417 tRNA-Phe
  9583. Salmonella sp. NW41 tRNA-Phe
  9584. Salmonella sp. NW420 tRNA-Phe
  9585. Salmonella sp. NW421 tRNA-Phe
  9586. Salmonella sp. NW422 tRNA-Phe
  9587. Salmonella sp. NW423 tRNA-Phe
  9588. Salmonella sp. NW426 tRNA-Phe
  9589. Salmonella sp. NW427 tRNA-Phe
  9590. Salmonella sp. NW428 tRNA-Phe
  9591. Salmonella sp. NW429 tRNA-Phe
  9592. Salmonella sp. NW42 tRNA-Phe
  9593. Salmonella sp. NW430 tRNA-Phe
  9594. Salmonella sp. NW432 tRNA-Phe
  9595. Salmonella sp. NW433 tRNA-Phe
  9596. Salmonella sp. NW434 tRNA-Phe
  9597. Salmonella sp. NW436 tRNA-Phe
  9598. Salmonella sp. NW437 tRNA-Phe
  9599. Salmonella sp. NW438 tRNA-Phe
  9600. Salmonella sp. NW43 tRNA-Phe
  9601. Salmonella sp. NW440 tRNA-Phe
  9602. Salmonella sp. NW441 tRNA-Phe
  9603. Salmonella sp. NW442 tRNA-Phe
  9604. Salmonella sp. NW444 tRNA-Phe
  9605. Salmonella sp. NW445 tRNA-Phe
  9606. Salmonella sp. NW448 tRNA-Phe
  9607. Salmonella sp. NW449 tRNA-Phe
  9608. Salmonella sp. NW44 tRNA-Phe
  9609. Salmonella sp. NW450 tRNA-Phe
  9610. Salmonella sp. NW451 tRNA-Phe
  9611. Salmonella sp. NW453 tRNA-Phe
  9612. Salmonella sp. NW454 tRNA-Phe
  9613. Salmonella sp. NW456 tRNA-Phe
  9614. Salmonella sp. NW457 tRNA-Phe
  9615. Salmonella sp. NW458 tRNA-Phe
  9616. Salmonella sp. NW459 tRNA-Phe
  9617. Salmonella sp. NW460 tRNA-Phe
  9618. Salmonella sp. NW462 tRNA-Phe
  9619. Salmonella sp. NW463 tRNA-Phe
  9620. Salmonella sp. NW464 tRNA-Phe
  9621. Salmonella sp. NW465 tRNA-Phe
  9622. Salmonella sp. NW467 tRNA-Phe
  9623. Salmonella sp. NW468 tRNA-Phe
  9624. Salmonella sp. NW469 tRNA-Phe
  9625. Salmonella sp. NW46 tRNA-Phe
  9626. Salmonella sp. NW470 tRNA-Phe
  9627. Salmonella sp. NW471 tRNA-Phe
  9628. Salmonella sp. NW472 tRNA-Phe
  9629. Salmonella sp. NW473 tRNA-Phe
  9630. Salmonella sp. NW474 tRNA-Phe
  9631. Salmonella sp. NW475 tRNA-Phe
  9632. Salmonella sp. NW476 tRNA-Phe
  9633. Salmonella sp. NW477 tRNA-Phe
  9634. Salmonella sp. NW478 tRNA-Phe
  9635. Salmonella sp. NW479 tRNA-Phe
  9636. Salmonella sp. NW47 tRNA-Phe
  9637. Salmonella sp. NW480 tRNA-Phe
  9638. Salmonella sp. NW481 tRNA-Phe
  9639. Salmonella sp. NW482 tRNA-Phe
  9640. Salmonella sp. NW483 tRNA-Phe
  9641. Salmonella sp. NW484 tRNA-Phe
  9642. Salmonella sp. NW485 tRNA-Phe
  9643. Salmonella sp. NW487 tRNA-Phe
  9644. Salmonella sp. NW488 tRNA-Phe
  9645. Salmonella sp. NW489 tRNA-Phe
  9646. Salmonella sp. NW48 tRNA-Phe
  9647. Salmonella sp. NW491 tRNA-Phe
  9648. Salmonella sp. NW492 tRNA-Phe
  9649. Salmonella sp. NW494 tRNA-Phe
  9650. Salmonella sp. NW495 tRNA-Phe
  9651. Salmonella sp. NW497 tRNA-Phe
  9652. Salmonella sp. NW499 tRNA-Phe
  9653. Salmonella sp. NW49 tRNA-Phe
  9654. Salmonella sp. NW4 tRNA-Phe
  9655. Salmonella sp. NW500 tRNA-Phe
  9656. Salmonella sp. NW502 tRNA-Phe
  9657. Salmonella sp. NW505 tRNA-Phe
  9658. Salmonella sp. NW507 tRNA-Phe
  9659. Salmonella sp. NW508 tRNA-Phe
  9660. Salmonella sp. NW509 tRNA-Phe
  9661. Salmonella sp. NW50 tRNA-Phe
  9662. Salmonella sp. NW510 tRNA-Phe
  9663. Salmonella sp. NW511 tRNA-Phe
  9664. Salmonella sp. NW512 tRNA-Phe
  9665. Salmonella sp. NW513 tRNA-Phe
  9666. Salmonella sp. NW514 tRNA-Phe
  9667. Salmonella sp. NW515 tRNA-Phe
  9668. Salmonella sp. NW516 tRNA-Phe
  9669. Salmonella sp. NW519 tRNA-Phe
  9670. Salmonella sp. NW51 tRNA-Phe
  9671. Salmonella sp. NW520 tRNA-Phe
  9672. Salmonella sp. NW522 tRNA-Phe
  9673. Salmonella sp. NW523 tRNA-Phe
  9674. Salmonella sp. NW527 tRNA-Phe
  9675. Salmonella sp. NW528 tRNA-Phe
  9676. Salmonella sp. NW529 tRNA-Phe
  9677. Salmonella sp. NW52 tRNA-Phe
  9678. Salmonella sp. NW530 tRNA-Phe
  9679. Salmonella sp. NW531 tRNA-Phe
  9680. Salmonella sp. NW534 tRNA-Phe
  9681. Salmonella sp. NW535 tRNA-Phe
  9682. Salmonella sp. NW536 tRNA-Phe
  9683. Salmonella sp. NW537 tRNA-Phe
  9684. Salmonella sp. NW538 tRNA-Phe
  9685. Salmonella sp. NW539 tRNA-Phe
  9686. Salmonella sp. NW53 tRNA-Phe
  9687. Salmonella sp. NW541 tRNA-Phe
  9688. Salmonella sp. NW543 tRNA-Phe
  9689. Salmonella sp. NW545 tRNA-Phe
  9690. Salmonella sp. NW546 tRNA-Phe
  9691. Salmonella sp. NW547 tRNA-Phe
  9692. Salmonella sp. NW548 tRNA-Phe
  9693. Salmonella sp. NW549 tRNA-Phe
  9694. Salmonella sp. NW54 tRNA-Phe
  9695. Salmonella sp. NW550 tRNA-Phe
  9696. Salmonella sp. NW551 tRNA-Phe
  9697. Salmonella sp. NW552 tRNA-Phe
  9698. Salmonella sp. NW553 tRNA-Phe
  9699. Salmonella sp. NW556 tRNA-Phe
  9700. Salmonella sp. NW557 tRNA-Phe
  9701. Salmonella sp. NW558 tRNA-Phe
  9702. Salmonella sp. NW559 tRNA-Phe
  9703. Salmonella sp. NW55 tRNA-Phe
  9704. Salmonella sp. NW562 tRNA-Phe
  9705. Salmonella sp. NW563 tRNA-Phe
  9706. Salmonella sp. NW564 tRNA-Phe
  9707. Salmonella sp. NW565 tRNA-Phe
  9708. Salmonella sp. NW568 tRNA-Phe
  9709. Salmonella sp. NW56 tRNA-Phe
  9710. Salmonella sp. NW570 tRNA-Phe
  9711. Salmonella sp. NW571 tRNA-Phe
  9712. Salmonella sp. NW572 tRNA-Phe
  9713. Salmonella sp. NW574 tRNA-Phe
  9714. Salmonella sp. NW576 tRNA-Phe
  9715. Salmonella sp. NW578 tRNA-Phe
  9716. Salmonella sp. NW579 tRNA-Phe
  9717. Salmonella sp. NW57 tRNA-Phe
  9718. Salmonella sp. NW580 tRNA-Phe
  9719. Salmonella sp. NW581 tRNA-Phe
  9720. Salmonella sp. NW582 tRNA-Phe
  9721. Salmonella sp. NW583 tRNA-Phe
  9722. Salmonella sp. NW584 tRNA-Phe
  9723. Salmonella sp. NW585 tRNA-Phe
  9724. Salmonella sp. NW587 tRNA-Phe
  9725. Salmonella sp. NW588 tRNA-Phe
  9726. Salmonella sp. NW58 tRNA-Phe
  9727. Salmonella sp. NW590 tRNA-Phe
  9728. Salmonella sp. NW591 tRNA-Phe
  9729. Salmonella sp. NW592 tRNA-Phe
  9730. Salmonella sp. NW593 tRNA-Phe
  9731. Salmonella sp. NW594 tRNA-Phe
  9732. Salmonella sp. NW596 tRNA-Phe
  9733. Salmonella sp. NW598 tRNA-Phe
  9734. Salmonella sp. NW599 tRNA-Phe
  9735. Salmonella sp. NW59 tRNA-Phe
  9736. Salmonella sp. NW5 tRNA-Phe
  9737. Salmonella sp. NW600 tRNA-Phe
  9738. Salmonella sp. NW601 tRNA-Phe
  9739. Salmonella sp. NW602 tRNA-Phe
  9740. Salmonella sp. NW603 tRNA-Phe
  9741. Salmonella sp. NW604 tRNA-Phe
  9742. Salmonella sp. NW605 tRNA-Phe
  9743. Salmonella sp. NW606 tRNA-Phe
  9744. Salmonella sp. NW607 tRNA-Phe
  9745. Salmonella sp. NW609 tRNA-Phe
  9746. Salmonella sp. NW60 tRNA-Phe
  9747. Salmonella sp. NW611 tRNA-Phe
  9748. Salmonella sp. NW613 tRNA-Phe
  9749. Salmonella sp. NW615 tRNA-Phe
  9750. Salmonella sp. NW616 tRNA-Phe
  9751. Salmonella sp. NW618 tRNA-Phe
  9752. Salmonella sp. NW619 tRNA-Phe
  9753. Salmonella sp. NW61 tRNA-Phe
  9754. Salmonella sp. NW620 tRNA-Phe
  9755. Salmonella sp. NW622 tRNA-Phe
  9756. Salmonella sp. NW623 tRNA-Phe
  9757. Salmonella sp. NW624 tRNA-Phe
  9758. Salmonella sp. NW625 tRNA-Phe
  9759. Salmonella sp. NW626 tRNA-Phe
  9760. Salmonella sp. NW627 tRNA-Phe
  9761. Salmonella sp. NW628 tRNA-Phe
  9762. Salmonella sp. NW629 tRNA-Phe
  9763. Salmonella sp. NW62 tRNA-Phe
  9764. Salmonella sp. NW631 tRNA-Phe
  9765. Salmonella sp. NW632 tRNA-Phe
  9766. Salmonella sp. NW633 tRNA-Phe
  9767. Salmonella sp. NW635 tRNA-Phe
  9768. Salmonella sp. NW636 tRNA-Phe
  9769. Salmonella sp. NW637 tRNA-Phe
  9770. Salmonella sp. NW638 tRNA-Phe
  9771. Salmonella sp. NW63 tRNA-Phe
  9772. Salmonella sp. NW640 tRNA-Phe
  9773. Salmonella sp. NW642 tRNA-Phe
  9774. Salmonella sp. NW643 tRNA-Phe
  9775. Salmonella sp. NW644 tRNA-Phe
  9776. Salmonella sp. NW645 tRNA-Phe
  9777. Salmonella sp. NW648 tRNA-Phe
  9778. Salmonella sp. NW649 tRNA-Phe
  9779. Salmonella sp. NW64 tRNA-Phe
  9780. Salmonella sp. NW651 tRNA-Phe
  9781. Salmonella sp. NW652 tRNA-Phe
  9782. Salmonella sp. NW654 tRNA-Phe
  9783. Salmonella sp. NW656 tRNA-Phe
  9784. Salmonella sp. NW657 tRNA-Phe
  9785. Salmonella sp. NW658 tRNA-Phe
  9786. Salmonella sp. NW659 tRNA-Phe
  9787. Salmonella sp. NW65 tRNA-Phe
  9788. Salmonella sp. NW662 tRNA-Phe
  9789. Salmonella sp. NW663 tRNA-Phe
  9790. Salmonella sp. NW666 tRNA-Phe
  9791. Salmonella sp. NW667 tRNA-Phe
  9792. Salmonella sp. NW668 tRNA-Phe
  9793. Salmonella sp. NW669 tRNA-Phe
  9794. Salmonella sp. NW66 tRNA-Phe
  9795. Salmonella sp. NW671 tRNA-Phe
  9796. Salmonella sp. NW672 tRNA-Phe
  9797. Salmonella sp. NW673 tRNA-Phe
  9798. Salmonella sp. NW674 tRNA-Phe
  9799. Salmonella sp. NW675 tRNA-Phe
  9800. Salmonella sp. NW677 tRNA-Phe
  9801. Salmonella sp. NW678 tRNA-Phe
  9802. Salmonella sp. NW679 tRNA-Phe
  9803. Salmonella sp. NW67 tRNA-Phe
  9804. Salmonella sp. NW680 tRNA-Phe
  9805. Salmonella sp. NW682 tRNA-Phe
  9806. Salmonella sp. NW686 tRNA-Phe
  9807. Salmonella sp. NW687 tRNA-Phe
  9808. Salmonella sp. NW68 tRNA-Phe
  9809. Salmonella sp. NW690 tRNA-Phe
  9810. Salmonella sp. NW691 tRNA-Phe
  9811. Salmonella sp. NW693 tRNA-Phe
  9812. Salmonella sp. NW697 tRNA-Phe
  9813. Salmonella sp. NW698 tRNA-Phe
  9814. Salmonella sp. NW69 tRNA-Phe
  9815. Salmonella sp. NW6 tRNA-Phe
  9816. Salmonella sp. NW701 tRNA-Phe
  9817. Salmonella sp. NW702 tRNA-Phe
  9818. Salmonella sp. NW703 tRNA-Phe
  9819. Salmonella sp. NW704 tRNA-Phe
  9820. Salmonella sp. NW706 tRNA-Phe
  9821. Salmonella sp. NW707 tRNA-Phe
  9822. Salmonella sp. NW708 tRNA-Phe
  9823. Salmonella sp. NW709 tRNA-Phe
  9824. Salmonella sp. NW70 tRNA-Phe
  9825. Salmonella sp. NW711 tRNA-Phe
  9826. Salmonella sp. NW714 tRNA-Phe
  9827. Salmonella sp. NW715 tRNA-Phe
  9828. Salmonella sp. NW716 tRNA-Phe
  9829. Salmonella sp. NW71 tRNA-Phe
  9830. Salmonella sp. NW720 tRNA-Phe
  9831. Salmonella sp. NW721 tRNA-Phe
  9832. Salmonella sp. NW722 tRNA-Phe
  9833. Salmonella sp. NW723 tRNA-Phe
  9834. Salmonella sp. NW724 tRNA-Phe
  9835. Salmonella sp. NW725 tRNA-Phe
  9836. Salmonella sp. NW726 tRNA-Phe
  9837. Salmonella sp. NW727 tRNA-Phe
  9838. Salmonella sp. NW728 tRNA-Phe
  9839. Salmonella sp. NW729 tRNA-Phe
  9840. Salmonella sp. NW72 tRNA-Phe
  9841. Salmonella sp. NW730 tRNA-Phe
  9842. Salmonella sp. NW731 tRNA-Phe
  9843. Salmonella sp. NW732 tRNA-Phe
  9844. Salmonella sp. NW734 tRNA-Phe
  9845. Salmonella sp. NW736 tRNA-Phe
  9846. Salmonella sp. NW737 tRNA-Phe
  9847. Salmonella sp. NW738 tRNA-Phe
  9848. Salmonella sp. NW739 tRNA-Phe
  9849. Salmonella sp. NW73 tRNA-Phe
  9850. Salmonella sp. NW740 tRNA-Phe
  9851. Salmonella sp. NW741 tRNA-Phe
  9852. Salmonella sp. NW743 tRNA-Phe
  9853. Salmonella sp. NW744 tRNA-Phe
  9854. Salmonella sp. NW746 tRNA-Phe
  9855. Salmonella sp. NW747 tRNA-Phe
  9856. Salmonella sp. NW748 tRNA-Phe
  9857. Salmonella sp. NW749 tRNA-Phe
  9858. Salmonella sp. NW74 tRNA-Phe
  9859. Salmonella sp. NW750 tRNA-Phe
  9860. Salmonella sp. NW751 tRNA-Phe
  9861. Salmonella sp. NW752 tRNA-Phe
  9862. Salmonella sp. NW753 tRNA-Phe
  9863. Salmonella sp. NW755 tRNA-Phe
  9864. Salmonella sp. NW756 tRNA-Phe
  9865. Salmonella sp. NW758 tRNA-Phe
  9866. Salmonella sp. NW75 tRNA-Phe
  9867. Salmonella sp. NW761 tRNA-Phe
  9868. Salmonella sp. NW763 tRNA-Phe
  9869. Salmonella sp. NW764 tRNA-Phe
  9870. Salmonella sp. NW765 tRNA-Phe
  9871. Salmonella sp. NW766 tRNA-Phe
  9872. Salmonella sp. NW767 tRNA-Phe
  9873. Salmonella sp. NW768 tRNA-Phe
  9874. Salmonella sp. NW76 tRNA-Phe
  9875. Salmonella sp. NW770 tRNA-Phe
  9876. Salmonella sp. NW771 tRNA-Phe
  9877. Salmonella sp. NW772 tRNA-Phe
  9878. Salmonella sp. NW774 tRNA-Phe
  9879. Salmonella sp. NW776 tRNA-Phe
  9880. Salmonella sp. NW778 tRNA-Phe
  9881. Salmonella sp. NW77 tRNA-Phe
  9882. Salmonella sp. NW780 tRNA-Phe
  9883. Salmonella sp. NW783 tRNA-Phe
  9884. Salmonella sp. NW785 tRNA-Phe
  9885. Salmonella sp. NW786 tRNA-Phe
  9886. Salmonella sp. NW789 tRNA-Phe
  9887. Salmonella sp. NW78 tRNA-Phe
  9888. Salmonella sp. NW790 tRNA-Phe
  9889. Salmonella sp. NW791 tRNA-Phe
  9890. Salmonella sp. NW792 tRNA-Phe
  9891. Salmonella sp. NW793 tRNA-Phe
  9892. Salmonella sp. NW794 tRNA-Phe
  9893. Salmonella sp. NW796 tRNA-Phe
  9894. Salmonella sp. NW797 tRNA-Phe
  9895. Salmonella sp. NW798 tRNA-Phe
  9896. Salmonella sp. NW79 tRNA-Phe
  9897. Salmonella sp. NW7 tRNA-Phe
  9898. Salmonella sp. NW800 tRNA-Phe
  9899. Salmonella sp. NW802 tRNA-Phe
  9900. Salmonella sp. NW803 tRNA-Phe
  9901. Salmonella sp. NW804 tRNA-Phe
  9902. Salmonella sp. NW805 tRNA-Phe
  9903. Salmonella sp. NW806 tRNA-Phe
  9904. Salmonella sp. NW807 tRNA-Phe
  9905. Salmonella sp. NW809 tRNA-Phe
  9906. Salmonella sp. NW810 tRNA-Phe
  9907. Salmonella sp. NW811 tRNA-Phe
  9908. Salmonella sp. NW812 tRNA-Phe
  9909. Salmonella sp. NW813 tRNA-Phe
  9910. Salmonella sp. NW814 tRNA-Phe
  9911. Salmonella sp. NW816 tRNA-Phe
  9912. Salmonella sp. NW817 tRNA-Phe
  9913. Salmonella sp. NW819 tRNA-Phe
  9914. Salmonella sp. NW81 tRNA-Phe
  9915. Salmonella sp. NW820 tRNA-Phe
  9916. Salmonella sp. NW822 tRNA-Phe
  9917. Salmonella sp. NW823 tRNA-Phe
  9918. Salmonella sp. NW824 tRNA-Phe
  9919. Salmonella sp. NW825 tRNA-Phe
  9920. Salmonella sp. NW826 tRNA-Phe
  9921. Salmonella sp. NW828 tRNA-Phe
  9922. Salmonella sp. NW829 tRNA-Phe
  9923. Salmonella sp. NW82 tRNA-Phe
  9924. Salmonella sp. NW830 tRNA-Phe
  9925. Salmonella sp. NW831 tRNA-Phe
  9926. Salmonella sp. NW832 tRNA-Phe
  9927. Salmonella sp. NW833 tRNA-Phe
  9928. Salmonella sp. NW834 tRNA-Phe
  9929. Salmonella sp. NW836 tRNA-Phe
  9930. Salmonella sp. NW837 tRNA-Phe
  9931. Salmonella sp. NW838 tRNA-Phe
  9932. Salmonella sp. NW83 tRNA-Phe
  9933. Salmonella sp. NW840 tRNA-Phe
  9934. Salmonella sp. NW842 tRNA-Phe
  9935. Salmonella sp. NW843 tRNA-Phe
  9936. Salmonella sp. NW844 tRNA-Phe
  9937. Salmonella sp. NW845 tRNA-Phe
  9938. Salmonella sp. NW846 tRNA-Phe
  9939. Salmonella sp. NW847 tRNA-Phe
  9940. Salmonella sp. NW849 tRNA-Phe
  9941. Salmonella sp. NW850 tRNA-Phe
  9942. Salmonella sp. NW851 tRNA-Phe
  9943. Salmonella sp. NW852 tRNA-Phe
  9944. Salmonella sp. NW854 tRNA-Phe
  9945. Salmonella sp. NW855 tRNA-Phe
  9946. Salmonella sp. NW856 tRNA-Phe
  9947. Salmonella sp. NW857 tRNA-Phe
  9948. Salmonella sp. NW858 tRNA-Phe
  9949. Salmonella sp. NW859 tRNA-Phe
  9950. Salmonella sp. NW85 tRNA-Phe
  9951. Salmonella sp. NW860 tRNA-Phe
  9952. Salmonella sp. NW861 tRNA-Phe
  9953. Salmonella sp. NW864 tRNA-Phe
  9954. Salmonella sp. NW865 tRNA-Phe
  9955. Salmonella sp. NW866 tRNA-Phe
  9956. Salmonella sp. NW869 tRNA-Phe
  9957. Salmonella sp. NW86 tRNA-Phe
  9958. Salmonella sp. NW870 tRNA-Phe
  9959. Salmonella sp. NW871 tRNA-Phe
  9960. Salmonella sp. NW872 tRNA-Phe
  9961. Salmonella sp. NW873 tRNA-Phe
  9962. Salmonella sp. NW874 tRNA-Phe
  9963. Salmonella sp. NW875 tRNA-Phe
  9964. Salmonella sp. NW876 tRNA-Phe
  9965. Salmonella sp. NW877 tRNA-Phe
  9966. Salmonella sp. NW878 tRNA-Phe
  9967. Salmonella sp. NW879 tRNA-Phe
  9968. Salmonella sp. NW87 tRNA-Phe
  9969. Salmonella sp. NW880 tRNA-Phe
  9970. Salmonella sp. NW881 tRNA-Phe
  9971. Salmonella sp. NW882 tRNA-Phe
  9972. Salmonella sp. NW883 tRNA-Phe
  9973. Salmonella sp. NW884 tRNA-Phe
  9974. Salmonella sp. NW885 tRNA-Phe
  9975. Salmonella sp. NW887 tRNA-Phe
  9976. Salmonella sp. NW888 tRNA-Phe
  9977. Salmonella sp. NW890 tRNA-Phe
  9978. Salmonella sp. NW891 tRNA-Phe
  9979. Salmonella sp. NW892 tRNA-Phe
  9980. Salmonella sp. NW893 tRNA-Phe
  9981. Salmonella sp. NW894 tRNA-Phe
  9982. Salmonella sp. NW895 tRNA-Phe
  9983. Salmonella sp. NW896 tRNA-Phe
  9984. Salmonella sp. NW897 tRNA-Phe
  9985. Salmonella sp. NW898 tRNA-Phe
  9986. Salmonella sp. NW899 tRNA-Phe
  9987. Salmonella sp. NW89 tRNA-Phe
  9988. Salmonella sp. NW8 tRNA-Phe
  9989. Salmonella sp. NW900 tRNA-Phe
  9990. Salmonella sp. NW901 tRNA-Phe
  9991. Salmonella sp. NW902 tRNA-Phe
  9992. Salmonella sp. NW903 tRNA-Phe
  9993. Salmonella sp. NW904 tRNA-Phe
  9994. Salmonella sp. NW905 tRNA-Phe
  9995. Salmonella sp. NW907 tRNA-Phe
  9996. Salmonella sp. NW908 tRNA-Phe
  9997. Salmonella sp. NW909 tRNA-Phe
  9998. Salmonella sp. NW90 tRNA-Phe
  9999. Salmonella sp. NW910 tRNA-Phe
  10000. Salmonella sp. NW911 tRNA-Phe
Relationships

Molecular Relationships

2D structure

Loading 2D structure...